Kinetics of TNF-alpha and IFN-gamma mRNA expression in islets and spleen of NOD mice

Insulin-dependent diabetes mellitus is caused by autoimmune destruction of pancreatic ß cells. Non-obese diabetic (NOD) mice spontaneously develop diabetes similar to the human disease. Cytokines produced by islet-infiltrating mononuclear cells may be directly cytotoxic and can be involved in islet destruction coordinated by CD4+ and CD8+ cells. We utilized a semiquantitative RT-PCR assay to analyze in vitro the mRNA expression of TNF-alpha and IFN-gamma cytokine genes in isolated islets (N = 100) and spleen cells (5 x 10(5) cells) from female NOD mice during the development of diabetes and from female CBA-j mice as a related control strain that does not develop diabetes. Cytokine mRNAs were measured at 2, 4, 8, 14 and 28 weeks of age from the onset of insulitis to the development of overt diabetes. An increase in IFN-gamma expression in islets was observed for females aged 28 weeks (149 ± 29 arbitrary units (AU), P<0.05, Student t-test) with advanced destructive insulitis when compared with CBA-j mice, while TNF-alpha was expressed in both NOD and CBA-j female islets at the same level at all ages studied. In contrast, TNF-alpha in spleen was expressed at higher levels in NOD females at 14 weeks (99 ± 8 AU, P<0.05) and 28 weeks (144 ± 17 AU, P<0.05) of age when compared to CBA-j mice. The data suggest that IFN-gamma and TNF-alpha expression in pancreatic islets of female NOD mice is associated with ß cell destruction and overt diabetes.

Effect of chronic fish oil supplementation on renal function of normal and cachectic rats

In the present study we determined the effect of chronic diet supplementation with n-3 PUFA on renal function of healthy and cachectic subjects by providing fish oil (1 g/kg body weight) to female rats throughout pregnancy and lactation and then to their offspring post-weaning and examined its effect on renal function parameters during their adulthood. The animals were divided into four groups of 5-10 rats in each group: control, control supplemented with fish oil (P), cachectic Walker 256 tumor-bearing (W), and W supplemented with fish oil (WP). Food intake was significantly lower in the W group compared to control (12.66 ± 4.24 vs 25.30 ± 1.07 g/day). Treatment with fish oil significantly reversed this reduction (22.70 ± 2.94 g/day). Tumor growth rate was markedly reduced in the P group (16.41 ± 2.09 for WP vs 24.06 ± 2.64 g for W). WP group showed a significant increase in mean glomerular filtration rate compared to P and control (1.520 ± 0.214 ml min-1 kg body weight-1; P < 0.05). Tumor-bearing groups had low urine osmolality compared to control rats. The fractional sodium excretion decreased in the W group compared to control (0.43 ± 0.16 vs 2.99 ± 0.87%; P < 0.05), and partially recovered in the WP group (0.90 ± 0.20%). In summary, the chronic supplementation with fish oil used in this study increased the amount of fat in the diet by only 0.1%, but caused remarkable changes in tumor growth rate and cachexia, also showing a renoprotective function.

Acetylcholine and bradykinin enhance hypotension and affect the function of remodeled conduit arteries in SHR and SHR treated with nitric oxide donors

Discrepancy was found between enhanced hypotension and attenuated relaxation of conduit arteries in response to acetylcholine (ACh) and bradykinin (BK) in nitric oxide (NO)-deficient hypertension. The question is whether a similar phenomenon occurs in spontaneously hypertensive rats (SHR) with a different pathogenesis. Wistar rats, SHR, and SHR treated with NO donors [molsidomine (50 mg/kg) or pentaerythritol tetranitrate (100 mg/kg), twice a day, by gavage] were studied. After 6 weeks of treatment systolic blood pressure (BP) was increased significantly in experimental groups. Under anesthesia, the carotid artery was cannulated for BP recording and the jugular vein for drug administration. The iliac artery was used for in vitro studies and determination of geometry. Compared to control, SHR showed a significantly enhanced (P < 0.01) hypotensive response to ACh (1 and 10 µg, 87.9 ± 6.9 and 108.1 ± 5.1 vs 35.9 ± 4.7 and 64.0 ± 3.3 mmHg), and BK (100 µg, 106.7 ± 8.3 vs 53.3 ± 5.2 mmHg). SHR receiving NO donors yielded similar results. In contrast, maximum relaxation of the iliac artery in response to ACh was attenuated in SHR (12.1 ± 3.6 vs 74.2 ± 8.6% in controls, P < 0.01). Iliac artery inner diameter also increased (680 ± 46 vs 828 ± 28 µm in controls, P < 0.01). Wall thickness, wall cross-section area, wall thickness/inner diameter ratio increased significantly (P < 0.01). No differences were found in this respect among SHR and SHR treated with NO donors. These findings demonstrated enhanced hypotension and attenuated relaxation of the conduit artery in response to NO activators in SHR and in SHR treated with NO donors, a response similar to that found in NO-deficient hypertension.

Regulation and function of neurogenesis in the adult vertebrate brain

Most adult tissues retain a reservoir of self-renewing, multipotent stem cells that can generate differentiated tissue components. Until recently, the brain was thought to be an exception to this rule and for many years the pervasive dogma of neurobiology relegated neurogenesis to the embryonic and earlier postnatal stages of development. The discovery of constant neuronal replacement in the adult brain has changed the way we think about neurological diseases and about the exploration of new strategies for brain repair. In this review we will explore the potential of adult neural stem cells and we will present some of our own work on this subject. We will also discuss the possibility that adult neurogenesis and neuronal replacement may also play a role in therapies aimed at restoring impaired brain function. A better understanding of the various aspects of spontaneous neuronal replacement may also be used to increase the success of procedures with cell therapies.

Impact of initial exposure to calcineurin inhibitors on kidney graft function of patients at high risk to develop delayed graft function

We conducted a retrospective analysis of the influence of full doses of calcineurin inhibitors [8-10 mg kg-1 day-1 cyclosporine (N = 80), or 0.2-0.3 mg kg-1 day-1 tacrolimus (N = 68)] administered from day 1 after transplantation on the transplant outcomes of a high-risk population. Induction therapy was used in 13% of the patients. Patients also received azathioprine (2 mg kg-1 day-1, N = 58) or mycophenolate mofetil (2 g/day, N = 90), and prednisone (0.5 mg kg-1 day-1, N = 148). Mean time on dialysis was 79 ± 41 months, 12% of the cases were re-transplants, and 21% had panel reactive antibodies >10%. In 43% of donors the cause of death was cerebrovascular disease and 27% showed creatinine above 1.5 mg/dL. The incidence of slow graft function (SGF) and delayed graft function (DGF) was 15 and 60%, respectively. Mean time to last dialysis and to nadir creatinine were 18 ± 15 and 34 ± 20 days, respectively. Mean creatinine at 1 year after transplantation was 1.48 ± 0.50 mg/dL (DGF 1.68 ± 0.65 vs SGF 1.67 ± 0.66 vs immediate graft function (IGF) 1.41 ± 0.40 mg/dL, P = 0.089). The incidence of biopsy-confirmed acute rejection was 22% (DGF 31%, SGF 10%, IGF 8%). One-year patient and graft survival was 92.6 and 78.4%, respectively. The incidence of cytomegalovirus disease, post-transplant diabetes mellitus and malignancies was 28, 8.1, and 0%, respectively. Compared to previous studies, the use of initial full doses of calcineurin inhibitors without antibody induction in patients with SGF or DGF had no negative impact on patient and graft survival.

Indoor NO2 air pollution and lung function of professional cooks

Studies of cooking-generated NO2 effects are rare in occupational epidemiology. In the present study, we evaluated the lung function of professional cooks exposed to NO2 in hospital kitchens. We performed spirometry in 37 cooks working in four hospital kitchens and estimated the predicted FVC, FEV1 and FEF25-75, based on age, sex, race, weight, and height, according to Knudson standards. NO2 measurements were obtained for 4 consecutive days during 4 different periods at 20-day intervals in each kitchen. Measurements were performed inside and outside the kitchens, simultaneously using Palm diffusion tubes. A time/exposure indicator was defined as representative of the cumulative exposure of each cook. No statistically significant effect of NO2 exposure on FVC was found. Each year of work as a cook corresponded to a decrease in predicted FEV1 of 2.5% (P = 0.046) for the group as a whole. When smoking status and asthma were included in the analysis the effect of time/exposure decreased about 10% and lost statistical significance. On predicted FEF25-75, a decrease of 3.5% (P = 0.035) was observed for the same group and the inclusion of controllers for smoking status and asthma did not affect the effects of time/exposure on pulmonary function parameter. After a 10-year period of work as cooks the participants of the study may present decreases in both predicted FEV1 and FEF25-75 that can reach 20 and 30%, respectively. The present study showed small but statistically significant adverse effects of gas stove exposure on the lung function of professional cooks.

Effect of metabolic syndrome and of its individual components on renal function of patients with type 2 diabetes mellitus

The objective of this study was to evaluate the effect of metabolic syndrome (MetS) and its individual components on the renal function of patients with type 2 diabetes mellitus (DM). A cross-sectional study was performed in 842 type 2 DM patients. A clinical and laboratory evaluation, including estimated glomerular filtration rate (eGFR) calculated by the modification of diet in renal disease formula, was performed. MetS was defined according to National Cholesterol Education Program - Adult Treatment Panel III criteria. Mean patient age was 57.9 ± 10.1 years and 313 (37.2%) patients were males. MetS was detected in 662 (78.6%) patients. A progressive reduction in eGFR was observed as the number of individual MetS components increased (one: 98.2 ± 30.8; two: 92.9 ± 28.1; three: 84.0 ± 25.1; four: 83.8 ± 28.5, and five: 79.0 ± 23.0; P < 0.001). MetS increased the risk for low eGFR (<60 mL·min-1·1.73 (m²)-1) 2.82-fold (95%CI = 1.55-5.12, P < 0.001). Hypertension (OR = 2.2, 95%CI = 1.39-3.49, P = 0.001) and hypertriglyceridemia (OR = 1.62, 95%CI = 1.19-2.20, P = 0.002) were the individual components with the strongest associations with low eGFR. In conclusion, there is an association between MetS and the reduction of eGFR in patients with type 2 DM, with hypertension and hypertriglyceridemia being the most important contributors in this sample. Interventional studies should be conducted to determine if treatment of MetS can prevent renal failure in type 2 DM patients.

The effect of microgravity on tissue structure and function of rat testis

To explore whether an environment of weightlessness will cause damage to the reproductive system of animals, we used the tail-suspension model to simulate microgravity, and investigated the effect of microgravity on the tissue structure and function of the testis in sexually mature male rats. Forty-eight male Wistar rats weighing 200-250 g were randomly assigned to three groups (N = 16 each): control, tail traction, and tail suspension. After the rats were suspended for 7 or 14 days, morphological changes of testis were evaluated by histological and electron microscopic methods. The expression of HSP70, bax/bcl-2 and AR (androgen receptor) in testis was measured by immunohistochemistry. Obvious pathological lesions were present in the testis after the rats were suspended for 7 or 14 days. We detected overexpression of HSP70 and an increase of apoptotic cells, which may have contributed to the injury to the testis. The expression of AR, as an effector molecule in the testis, was significantly decreased in the suspended groups compared to control (P < 0.01). We also observed that, with a longer time of suspension, the aforementioned pathological damage became more serious and some pathological injury to the testis was irreversible. The results demonstrated that a short- or medium-term microgravity environment could lead to severe irreversible damage to the structure of rat testis.

Effect of thymosin alpha-1 on subpopulations of Th1, Th2, Th17, and regulatory T cells (Tregs) in vitro

Thymosin alpha 1 (Tα1) has been shown to have beneficial effects on numerous immune system parameters, but little is known about the effects of Tα1 on patients with gastric carcinoma. The objective of this study was to determine the effect of Tα1 on subpopulations of Th1, Th2, Th17, and regulatory T cells (Tregs) in vitro, and to evaluate its efficacy as an immunoregulatory factor in patients with gastric carcinoma. We compared the effect of Tα1 on the frequency of CD4+ and CD8+ T cells, especially the CD4+CD25+Foxp3+ Tregs in peripheral blood mononuclear cells (PBMCs) from gastric carcinoma patients (N = 35) and healthy donors (N = 22). We also analyzed the changes in the proliferation of PBMCs in response to treatment with Tα1, and examined the production of Th1, Th2, and Th17 cytokines by PBMCs and tumor-infiltrating lymphocytes. The treatment of PBMCs from gastric cancer patients, with Tα1 (50 µg/mL) alone increased the percentage of CD4+CD25+Foxp3+ (suppressive antitumor-specific Tregs) from 1.68 ± 0.697 to 2.19 ± 0.795% (P < 0.05). Our results indicate that Tα1 increases the percentage of Tregs and IL-1β, TNF-α, and IL-6 in vitro.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Diabetes mellitus affects the biomechanical function of the callus and the expression of TGF-beta1 and BMP2 in an early stage of fracture healing

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

Effect of hyperbaric oxygenation on mitochondrial function of neuronal cells in the cortex of neonatal rats after hypoxic-ischemic brain damage

The timing and mechanisms of protection by hyperbaric oxygenation (HBO) in hypoxic-ischemic brain damage (HIBD) have only been partially elucidated. We monitored the effect of HBO on the mitochondrial function of neuronal cells in the cerebral cortex of neonatal rats after HIBD. Neonatal Sprague-Dawley rats (total of 360 of both genders) were randomly divided into normal control, HIBD, and HIBD+HBO groups. The HBO treatment began immediately after hypoxia-ischemia (HI) and continued once a day for 7 consecutive days. Animals were euthanized 0, 2, 4, 6, and 12 h post-HI to monitor the changes in mitochondrial membrane potential (ΔΨm) occurring soon after a single dose of HBO treatment, as well as 2, 3, 4, 5, 6, and 7 days post-HI to study ΔΨm changes after a series of HBO treatments. Fluctuations in ΔΨm were observed in the ipsilateral cortex in both HIBD and HIBD+HBO groups. Within 2 to 12 h after HI insult, the ΔΨm of the HIBD and HIBD+HBO groups recovered to some extent. A secondary drop in ΔΨm was observed in both groups during the 1-4 days post-HI period, but was more severe in the HIBD+HBO group. There was a secondary recovery of ΔΨm observed in the HIBD+HBO group, but not in the HIBD group, during the 5-7 days period after HI insult. HBO therapy may not lead to improvement of neural cell mitochondrial function in the cerebral cortex in the early stage post-HI, but may improve it in the sub-acute stage post-HI.

Thermophysical and rheological properties of dulce de leche with and without coconut flakes as a function of temperature

Dulce de leche (DL), a dairy dessert highly appreciated in Brazil, is a concentrated product containing about 70% m/m of total solids. Thermophysical and rheological properties of two industrial Brazilian Dulce de leche formulations (classic Dulce de leche and Dulce de leche added with coconut flakes 1.5% m/m) were determined at temperatures comprised between 28.4 and 76.4 °C. In general, no significant differences (p < 0.05) were observed in the presence of coconut flakes in the two formulations. Heat capacity varied from 2633.2 to 3101.8 J/kg.°C; thermal conductivity from 0.383 to 0.452 W/m.°C; specific mass from 1350.7 to 1310.7 kg/m³; and, thermal diffusivity from (1.082 × 10-7 to 1.130 × 10-7) m²/s. The Bingham model was used to properly describe the non-Newtonian behavior of both formulations, with yielding stress values varying from 27.3 to 17.6 Pa and plastic viscosity from 19.9 to 5.9 Pa.s.

Oxidative enzymes activity in sugarcane juice as a function of the planting system

In Brazil, the largest producer of sugarcane in the world, the industrial process transforms this crop into ethanol and/or granulated sugar. Some cultivars exhibit enzymatic browning in the extracted sugarcane juice at levels harmful to the manufacturing process of white granulated sugar. The objective of this study was to assess the effect of sugarcane straw used as soil coverage, the use of different planting systems, and treatments with hydrogel polymer on enzymatic activity. The cultivar RB 86 7515 was sampled for 8 months; the first sample was obtained by cutting the upper portion of the stalk at the internode, which was taken to the laboratory for determination of the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The soil coverage with different forms of straw as well as the planting systems did not change the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The polyphenoloxidase (PPO) activity increased with the use of a polymer due to increased polyphenoloxidase (PPO) activity in the groove system. The enzymes studied showed changes in activity during the experimental period. The production of sugar at the end of the season (August to November) avoids the periods of highest enzymatic activity.