56 resultados para Permeable reactive barrier
Resumo:
The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.
Resumo:
Tolerance to lipopolysaccharide (LPS) occurs when animals or cells exposed to LPS become hyporesponsive to a subsequent challenge with LPS. This mechanism is believed to be involved in the down-regulation of cellular responses observed in septic patients. The aim of this investigation was to evaluate LPS-induced monocyte tolerance of healthy volunteers using whole blood. The detection of intracellular IL-6, bacterial phagocytosis and reactive oxygen species (ROS) was determined by flow cytometry, using anti-IL-6-PE, heat-killed Staphylococcus aureus stained with propidium iodide and 2',7'-dichlorofluorescein diacetate, respectively. Monocytes were gated in whole blood by combining FSC and SSC parameters and CD14-positive staining. The exposure to increasing LPS concentrations resulted in lower intracellular concentration of IL-6 in monocytes after challenge. A similar effect was observed with challenge with MALP-2 (a Toll-like receptor (TLR)2/6 agonist) and killed Pseudomonas aeruginosa and S. aureus, but not with flagellin (a TLR5 agonist). LPS conditioning with 15 ng/mL resulted in a 40% reduction of IL-6 in monocytes. In contrast, phagocytosis of P. aeruginosa and S. aureus and induced ROS generation were preserved or increased in tolerant cells. The phenomenon of tolerance involves a complex regulation in which the production of IL-6 was diminished, whereas the bacterial phagocytosis and production of ROS was preserved. Decreased production of proinflammatory cytokines and preserved or increased production of ROS may be an adaptation to control the deleterious effects of inflammation while preserving antimicrobial activity.
Resumo:
Recent studies have reported that exogenous gangliosides, the sialic acid-containing glycosphingolipids, are able to modulate many cellular functions. We examined the effect of micelles of mono- and trisialoganglioside GM1 and GT1b on the production of reactive oxygen species by stimulated human polymorphonuclear neutrophils using different spectroscopic methods. The results indicated that exogenous gangliosides did not influence extracellular superoxide anion (O2.-) generation by polymorphonuclear neutrophils activated by receptor-dependent formyl-methionyl-leucyl-phenylalanine. However, when neutrophils were stimulated by receptor-bypassing phorbol 12-myristate 13-acetate (PMA), gangliosides above their critical micellar concentrations prolonged the lag time preceding the production in a concentration-dependent way, without affecting total extracellular O2.- generation detected by superoxide dismutase-inhibitable cytochrome c reduction. The effect of ganglioside GT1b (100 µM) on the increase in lag time was shown to be significant by means of both superoxide dismutase-inhibitable cytochrome c reduction assay and electron paramagnetic resonance spectroscopy (P < 0.0001 and P < 0.005, respectively). The observed phenomena can be attributed to the ability of ganglioside micelles attached to the cell surface to slow down PMA uptake, thus increasing the diffusion barrier and consequently delaying membrane events responsible for PMA-stimulated O2.- production.
Resumo:
Neurogenic hypertension has been the subject of extensive research worldwide. This review is based on the premise that some forms of neurogenic hypertension are caused in part by the formation of angiotensin-II (Ang-II)-induced reactive oxygen species along the subfornical organ-paraventricular nucleus of the hypothalamus-rostral ventrolateral medulla pathway (SFO-PVN-RVLM pathway). We will discuss the recent contribution of our laboratory and others regarding the mechanisms by which neurons in the SFO (an important circumventricular organ) are activated by Ang-II, how the SFO communicates with two other important areas involved in sympathetic activity regulation (PVN and RVLM) and how Ang-II-induced reactive oxygen species participate along the SFO-PVN-RVLM pathway in the pathogenesis of neurogenic hypertension.
Resumo:
The measurement of the serum concentration of the acute-phase reactant C-reactive protein (CRP) provides a useful marker in clinical practice. However, the distribution of CRP is not available for all age and population groups. This study assessed the distribution of high sensitivity-CRP (hs-CRP) by gender and age in 1470 elderly individuals from a Brazilian community that participates in the Bambuí Cohort Study. Blood samples were collected after 12 h of fasting and serum samples were stored at -70°C. Measurements were made with a commercial hs-CRP immunonephelometric instrument. More than 50% of the results were above 3.0 mg/L for both genders. Mean hs-CRP was higher in women (3.62 ± 2.58 mg/L) than in men (3.03 ± 2.50 mg/L). This difference was observed for all ages, except for the over-80 age group. This is the first population-based study to describe hs-CRP values in Latin American elderly subjects. Our results indicate that significant gender differences exist in the distribution of hs-CRP, and suggest that gender-specific cut-off points for hs-CRP would be necessary for the prediction of cardiovascular risks.
Resumo:
The objective of this study was to evaluate cardiorespiratory fitness and pulmonary function and the relationship with metabolic variables and C-reactive protein (CRP) plasma levels in individuals with diabetes mellitus (DM). Nineteen men with diabetes and 19 age- and gender-matched control subjects were studied. All individuals were given incremental cardiopulmonary exercise and pulmonary function tests. In the exercise test, maximal workload (158.3±22.3vs 135.1±25.2, P=0.005), peak heart rate (HRpeak: 149±12 vs 139±10, P=0.009), peak oxygen uptake (VO2peak: 24.2±3.2 vs18.9±2.8, P<0.001), and anaerobic threshold (VO2VT: 14.1±3.4 vs 12.2±2.2, P=0.04) were significantly lower in individuals with diabetes than in control subjects. Pulmonary function test parameters, blood pressure, lipid profile (triglycerides, HDL, LDL, and total cholesterol), and CRP plasma levels were not different in control subjects and individuals with DM. No correlations were observed between hemoglobin A1C (HbA1c), CRP and pulmonary function test and cardiopulmonary exercise test performance. In conclusion, the results demonstrate that nonsmoking individuals with DM have decreased cardiorespiratory fitness that is not correlated with resting pulmonary function parameters, HbA1c, and CRP plasma levels.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
It is currently accepted that superoxide anion (O2•−) is an important mediator in pain and inflammation. The role of superoxide anion in pain and inflammation has been mainly determined indirectly by modulating its production and inactivation. Direct evidence using potassium superoxide (KO2), a superoxide anion donor, demonstrated that it induced thermal hyperalgesia, as assessed by the Hargreaves method. However, it remains to be determined whether KO2 is capable of inducing other inflammatory and nociceptive responses attributed to superoxide anion. Therefore, in the present study, we investigated the nociceptive and inflammatory effects of KO2. The KO2-induced inflammatory responses evaluated in mice were: mechanical hyperalgesia (electronic version of von Frey filaments), thermal hyperalgesia (hot plate), edema (caliper rule), myeloperoxidase activity (colorimetric assay), overt pain-like behaviors (flinches, time spent licking and writhing score), leukocyte recruitment, oxidative stress, and cyclooxygenase-2 mRNA expression (quantitative PCR). Administration of KO2 induced mechanical hyperalgesia, thermal hyperalgesia, paw edema, leukocyte recruitment, the writhing response, paw flinching, and paw licking in a dose-dependent manner. KO2 also induced time-dependent cyclooxygenase-2 mRNA expression in the paw skin. The nociceptive, inflammatory, and oxidative stress components of KO2-induced responses were responsive to morphine (analgesic opioid), quercetin (antioxidant flavonoid), and/or celecoxib (anti-inflammatory cyclooxygenase-2 inhibitor) treatment. In conclusion, the well-established superoxide anion donor KO2 is a valuable tool for studying the mechanisms and pharmacological susceptibilities of superoxide anion-triggered nociceptive and inflammatory responses ranging from mechanical and thermal hyperalgesia to overt pain-like behaviors, edema, and leukocyte recruitment.
Resumo:
Recent studies have revealed that an intrinsic apoptotic signaling cascade is involved in vascular hyperpermeability and endothelial barrier dysfunction. Propofol (2,6-diisopropylphenol) has also been reported to inhibit apoptotic signaling by regulating mitochondrial permeability transition pore (mPTP) opening and caspase-3 activation. Here, we investigated whether propofol could alleviate burn serum-induced endothelial hyperpermeability through the inhibition of the intrinsic apoptotic signaling cascade. Rat lung microvascular endothelial cells (RLMVECs) were pretreated with propofol at various concentrations, followed by stimulation with burn serum, obtained from burn-injury rats. Monolayer permeability was determined by transendothelial electrical resistance. Mitochondrial release of cytochrome C was measured by ELISA. Bax and Bcl-2 expression and mitochondrial release of second mitochondrial-derived activator of caspases (smac) were detected by Western blotting. Caspase-3 activity was assessed by fluorometric assay; mitochondrial membrane potential (Δψm) was determined with JC-1 (a potential-sensitive fluorescent dye). Intracellular ATP content was assayed using a commercial kit, and reactive oxygen species (ROS) were measured by dichlorodihydrofluorescein diacetate (DCFH-DA). Burn serum significantly increased monolayer permeability (P<0.05), and this effect could be inhibited by propofol (P<0.05). Compared with a sham treatment group, intrinsic apoptotic signaling activation - indicated by Bax overexpression, Bcl-2 downregulation, Δψm reduction, decreased intracellular ATP level, increased cytosolic cytochrome C and smac, and caspase-3 activation - was observed in the vehicle group. Propofol not only attenuated these alterations (P<0.05 for all), but also significantly decreased burn-induced ROS production (P<0.05). Propofol attenuated burn-induced RLMVEC monolayer hyperpermeability by regulating the intrinsic apoptotic signaling pathway.
Resumo:
The contents of total phenolic compounds (TPC), total flavonoids (TF), and ascorbic acid (AA) of 18 frozen fruit pulps and their scavenging capacities against peroxyl radical (ROO), hydrogen peroxide (H2O2), and hydroxyl radical (OH) were determined. Principal Component Analysis (PCA) showed that TPC (total phenolic compounds) and AA (ascorbic acid) presented positive correlation with the scavenging capacity against ROO, and TF (total flavonoids) showed positive correlation with the scavenging capacity against OH and ROO However, the scavenging capacity against H2O2 presented low correlation with TF (total flavonoids), TPC (total phenolic compounds), and AA (ascorbic acid). The Hierarchical Cluster Analysis (HCA) allowed the classification of the fruit pulps into three groups: one group was formed by the açai pulp with high TF, total flavonoids, content (134.02 mg CE/100 g pulp) and the highest scavenging capacity against ROO, OH and H2O2; the second group was formed by the acerola pulp with high TPC, total phenolic compounds, (658.40 mg GAE/100 g pulp) and AA , ascorbic acid, (506.27 mg/100 g pulp) contents; and the third group was formed by pineapple, cacao, caja, cashew-apple, coconut, cupuaçu, guava, orange, lemon, mango, passion fruit, watermelon, pitanga, tamarind, tangerine, and umbu pulps, which could not be separated considering only the contents of bioactive compounds and the scavenging properties.