Estimativa do período que antecede a interferência de plantas daninhas na cultura da soja, Var. Coodetec 202, por meio de testemunhas duplas

O objetivo deste trabalho foi determinar o período anterior à interferência (PAI) em soja, var. Coodetec 202, em área de plantio direto na região de Maringá-PR, utilizando o sistema de testemunhas duplas. A principal infestante da área após a instalação da cultura foi Bidens pilosa, numa densidade de infestação de 50 a 70 plantas m-2. Outras plantas daninhas presentes na área foram Euphorbia heterophylla, Brachiaria plantaginea, Sida rhombifolia, Acanthospermum hispidum, Commelina benghalensis, Cenchrus echinatus e Desmodium tortuosum. A cultura foi mantida na presença de plantas daninhas por períodos de interferência crescentes (7, 10, 14, 21, 28, 35, 42, 49 dias e ciclo completo 118 dias) a partir da emergência da soja. Após cada período de interferência, as plantas daninhas foram eliminadas por capina e remoção manual, mantendo-se a soja no limpo até a colheita. Além dos nove períodos de interferência, foram instalados dois tratamentos-padrão adicionais com herbicidas, aplicados em PRÉ (após a semeadura) e em PÓS (aos 18 dias após a emergência da cultura). Conclui-se que com a utilização de testemunhas duplas foi possível estabelecer um PAI de 10 dias para a cultura da soja (var. Coodetec 202), após sua emergência. Quanto aos tratamentos herbicidas, com a mistura pré-emergente (diclosulam + flumetsulam) não se observou nenhum efeito negativo sobre a produtividade, porém com a utilização da mistura pós-emergente (lactofen + chlorimuron-ethyl), aos 18 dias após a emergência, houve redução de produtividade.

Interaction between paraventricular nucleus and septal area in the control of physiological responses induced by angiotensin II

We determined the effects of losartan (40 nmol) and PD 123319 (40 nmol) (both non-peptides and selective antagonists of the AT1 and AT2 angiotensin receptors, respectively), and [Sar¹, Ala8] angiotensin II (ANG II) (40 nmol) (a non-selective peptide antagonist of angiotensin receptors) injected into the paraventricular nucleus (PVN) on the water and salt appetite, diuresis and natriuresis and mean arterial pressure (MAP) induced by administration of 10 nmol of ANG II into the medial septal area (MSA) of male Holtzman rats weighing 250-300 g. The volume of drug solution injected was 0.5 µl over a period of 10-15 s. The responses were measured over a period of 120 min. ANG II alone injected into the MSA induced an increase in all the above parameters (8.1 ± 1.2, 1.8 ± 0.3, and 17.1 ± 1.0 ml, 217 ± 25 µEq/120 min, and 24 ± 4 mmHg, respectively, N = 10-12) compared with vehicle-treated rats (1.4 ± 0.2, 0.6 ± 0.1, and 9.3 ± 0.5 ml, 47 ± 5 µEq/120 min, and 4.1 ± 0.8 mmHg, respectively, N = 10-14). Pretreatment with losartan and [Sar¹, Ala8] ANG II completely abolished the water and sodium intake, and the pressor increase (0.5 ± 0.2, 1.1 ± 0.2, 0.5 ± 0.2, and 0.8 ± 0.2 ml, and 1.2 ± 3.9, 31 ± 4.6 mmHg, respectively, N = 9-12), whereas losartan blunted the urinary and sodium excretion induced by ANG II (13.9 ± 1.0 ml and 187 ± 10 µEq/120 min, respectively, N = 9). Pretreatment with PD 123319 and [Sar¹, Ala8] ANG II blocked the urinary and sodium excretion (10.7 ± 0.8, 9.8 ± 0.7 ml, and 67 ± 13 and 57 ± 17 µEq/120 min, respectively, N = 9), whereas pretreatment with PD 123319 partially blocked the water and sodium intake, and the MAP induced by ANG II administration (2.3 ± 0.3, 1.1 ± 0.1 ml, and 12 ± 3 mmHg, respectively, N = 9-10). These results suggest the angiotensinergic effect of the MSA on the AT1 and AT2 receptors of the PVN in terms of water and sodium homeostasis and MAP modulation.

Cardiovascular risk factors in a population of Brazilian schoolchildren

Epidemiological and clinical evidence suggests that a judicious diet, regular physical activity and blood pressure (BP) monitoring must start in early childhood to minimize the impact of modifiable cardiovascular risk factors. This study was designed to evaluate BP and metabolic parameters of schoolchildren from Vitória, Espírito Santo State, Brazil, and correlate them with cardiovascular risk factors. The study was conducted on 380 students aged 10-14 years (177 boys, 203 girls) enrolled in public schools. Baseline measurements included body mass index, BP and heart rate. The students were submitted to exercise spirometry on a treadmill. VO2max was obtained from exercise testing to voluntary exhaustion. Fasting serum total cholesterol (TC), LDL-C, HDL-C, triglycerides (TG), and glucose were measured. Nine point nine percent of the boys and 11.7% of the girls were hypertensive or had pre-hypertensive levels. There was no significant correlation between VO2max and TC, LDL-C, or TG in prepubertal children, but a slight negative correlation was detected in post-pubertal boys for HDL-C and TG. In addition, children with hypertension (3.4%) or pre-hypertensive levels (6.6%) also had comorbidity for overweight and blood lipid abnormalities (14% for triglycerides, 44.7% for TC, 25.9% for LDL-C, 52% for low HDL-C). The present study shows for the first time high correlations between prehypertensive blood pressure levels and the cardiovascular risk factors high TC, high LDL-C, low HDL-C in schoolchildren. These are important for the formulation of public health policies and strategies.

Prevalence of diphtheria and tetanus antibodies and circulation of Corynebacterium diphtheriae in São Paulo, Brazil

The introduction of routine vaccination against tetanus and diphtheria in Brazil has decreased the incidence and changed the epidemiology of both diseases. We then investigated the prevalence of Corynebacterium diphtheriae carrier status and diphtheria and tetanus immunity in São Paulo, Brazil. From November 2001 to March 2003, 374 individuals were tested for the presence of C. diphtheriae in the naso-oropharynx and of serum diphtheria and tetanus antibodies. Participants were all healthy individuals without acute or chronic pathologies and they were stratified by age as follows: 0-12 months and 1-4, 5-9, 10-14, 15-24, 25-39, 40-59, and ³60 years. Antibodies were assessed using a double-antigen ELISA. C. diphtheriae species were identified by biochemical analysis and toxigenicity was assessed by the Elek test. For diphtheria, full protection (antibodies ³0.1 IU/mL) was present in 84% of the individuals, 15% had basic protection (antibodies ³0.01 and <0.1 IU/mL) and 1% were susceptible (antibodies <0.01 IU/mL). Full tetanus protection (antibodies ³0.1 IU/mL) was present in 79% of the participants, 18% had basic protection (antibodies ³0.01 and <0.1 IU/mL) and 3% were susceptible (antibodies <0.01 IU/mL). The geometric mean of diphtheria and tetanus antibodies reached the highest values at 5-9 years and decreased until the 40-59-year age range, increasing again in individuals over 60 years. Three participants (0.8%) were carriers of C. diphtheriae, all non-toxigenic strains. The present results demonstrate the clear need of periodic booster for tetanus and diphtheria vaccine in adolescents and adults after primary immunization in childhood.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Perfil de textura e umidade espremível de géis do albume de ovos recobertos com soro de leite

A gelatinização é uma importante propriedade funcional das proteínas alimentares, devido ao seu grande potencial de uso nos alimentos estruturados. As proteínas da clara do ovo de galinha têm sido extensivamente usadas como ingredientes em alimentos processados. O objetivo deste trabalho foi avaliar as mudanças no pH, no perfil de textura e na umidade espremível de géis de clara de ovos de galinha com e sem cobertura de concentrado protéico de soro de leite, armazenados a 25ºC, por 3, 7, 10, 14, 21 e 28 dias. A dureza do gel do albume de ovos sem cobertura foi maior do que a de ovos recobertos, durante todos os períodos de armazenamento. Não houve efeito do tempo de armazenamento na dureza dos géis dos ovos sem cobertura. Em ovos cobertos, a regressão linear explicou 60% do comportamento da dureza em relação ao período de armazenamento. No caso da elasticidade, não houve interação entre período de armazenamento e a cobertura. Houve diferença entre as médias dentro de cada período, mas não durante o armazenamento. A maior elasticidade foi dos géis de ovos sem cobertura, comparados com os géis de ovos recobertos. O índice de coesividade e a mastigabilidade de géis de ovos sem cobertura foi maior que o de géis de ovos recobertos, em todos os períodos de armazenamento. A percentagem de umidade espremível (UE) de géis de clara de ovos recobertos foi maior do que a de ovos sem cobertura em todo o período de estocagem.

Hidrólise enzimática do óleo de pescado

O óleo de pescado tem sido alvo de várias pesquisas em função dos benefícios nutricionais dos ácidos graxos poliinsaturados. Esse fato pode ser comprovado pelos estudos epidemiológicos que relacionam a baixa incidência de doenças cardiovasculares com o consumo de ácidos graxos n-3 (EPA-eicosapentaenóico e DHA-docosahexaenóico) provenientes de peixes marinhos. A obtenção de ácidos graxos poliinsaturados n-3 pode ser realizada por hidrólise enzimática. A hidrólise enzimática de óleos e gorduras, ou lipólise, é bem conhecida e vem sendo estudada para produzir ácidos graxos e modificar as gorduras por esterificação, transesterificação e interesterificação. O objetivo deste trabalho foi a obtenção de ácidos graxos poliinsaturados por hidrólise enzimática do óleo de pescado industrial. A hidrólise de 1262,81 µmoles de óleo de pescado com lipase pancreática porcina (concentração de extrato enzimático de 7,647 mg.mL-1), 60 minutos, 38 °C, pH 8, tampão NH4Cl-NH4OH. Os produtos da hidrólise foram separados por cromatografia em coluna e caracterizados por cromatografia em camada delgada (TLC) e gasosa (GLC). A enzima apresentou uma atividade específica de 10,14 ± 0,15 UE.mg de proteínas-1 e com 60 minutos de reação se obteve 44,45% de hidrólise com 1865,76 ± 41,15 µmols de ácidos graxos. Foram identificados ácidos graxos livres, mono-acilgliceróis, di-acilgliceróis e tri-acilgliceróis. Na fração dos tri-acilgliceróis verificou-se um aumento de 46,14% e 40,23% de ácido araquidônico e eicosapentaenóico (EPA) respectivamente, enquanto que na fração monoacilglicerol um acréscimo de 96,96% e 52,55% de DPA e DHA.

Effect of osmotic predehydration on drying characteristics of banana fruits

Osmotic dehydration is considered to be a suitable preprocessing step to reduce the water content of foods. Such products can be dried further by conventional drying processes to lower their water activity and thus extend their shelf life. In this work, banana (Musa sapientum) fruits were initially treated by osmosis by varying several parameters of the processing conditions which included, besides the cutting format (longitudinal and round slices) of the fruit, temperature (28 and 49 ºC), syrup concentration (50, 60 and 67 ºBrix), treatment time (2, 4, 6, 10, 14, 16 and 18 hours), fruit and syrup ratio (1:1, 1:2, 1:3 and 1:4) and agitation effects. The best quality products were obtained by the use of the 67 ºBrix syrup, for 60 minutes of osmotic treatment, at 28 ºC, having a fruit and syrup ratio of 1:1 and agitation. The experimental data obtained on reduction in moisture content during the osmotic treatment were correlated with the experimental equation of M/Mo = Ae(-Kt), where A and K are the constants which represent the geometry and effective diffusivity of the drying process. This simplified mathematical model correlated well with the experimental results.

Effects of heat treatment and storage temperature on the use of açaí drink by nutraceutical and beverage industries

This study assesses the storage temperature effect on the anthocyanins of pasteurized and unpasteurized açaí pulp. The data was obtained using a pasteurized and lyophilized pulp (PLP) to evaluate the temperature effect (0, 25, and 40 °C). Part of non-pasteurized frozen pulp (NPP) was pasteurized (NPP-P) at 90 °C for 30 seconds; both pulps were stored at 40 °C. The anthocyanin content reduction in the drink was evaluated from the half-life time (t1/2), activation energy (Ea), temperature quotient (Q10), and the reaction rate constant (k). The t1/2 of the PLP anthocyanins stored at 40 °C was 1.8 times less than that stored at 25 °C and 15 times less than that stored at 0 °C; therefore, the higher temperatures decreased the stability of anthocyanins. The pasteurization increased the t1/2 by 6.6 times (10.14 hours for NPP and 67.28 hours for NPP-P). The anthocyanin degradation on NPP-P followed a first order kinetic, while NPP followed a second order kinetic; thus it can be said that the pasteurization process can improve the preservation of anthocyanins in the pulp.

Antioxidants in yacon products and effect of long term storage

Yacon (Smallanthus sonchifolius (Poepp. and Endl.) H. Robinson) is a storage root originally grown in the Andean highlands. The fresh roots are perishable and quickly turn brown during handling and processing. Aiming to prolong shelf-life and to preserve the antioxidant compounds in yacon roots, 3 mm thick yacon slices were dried in a drying cabinet at 40, 50, and 60 ºC to a moisture content of 10-14%, and yacon strips were sun dried to a moisture content of 15-20%. The total phenolic content was measured by the Folin-Ciocalteu method, and the quenching capacity was evaluated by measuring the amount of DPPH (1,1-diphenyl-2-pidrylhydrazyl) inhibited in samples after drying and after 7 months of storage. The results showed that it is possible to preserve the antioxidant capacity in yacon after cabinet or sun drying. Both yacon chips and strips presented total phenolic content values similar to those of fresh yacon roots. Both products also showed a high inhibition capacity of DPPH (1,1-diphenyl-2-pidrylhydrazyl). A significant decrease in the phenolic content was observed in the yacon chips after storage, which indicates that the sun dried strips are more suitable for storage.

Variation of some chemical and functional properties of Bambara groundnut (Voandzeia Subterranean L. Thouars) during sort time storage

Abstract The storage susceptibility of Bambara groundnut (B. G.) (Voandzeia Subterranean (L.) Thouars) to Callosobruchus maculatus and chemical and functional properties of 11 varieties form Far-North of Cameroon were investigate using standard analytical methods. Storage susceptibility shown that, after five months within treatment, C. maculatus destroy 10 to 50% of grains. The chemical characteristics of none attack grains of 11 varieties were range to 18.64 at 21.08%, 6.85 at 7.44%, 49.75 at 52.68% and to 6.05 at 7.55% respectively for protein, fat, starch and free carbohydrate. These chemical characteristics significantly (p < 0.05) decreases form attacks varieties. For the functional parameters, the none attacks grains was range of 130 at 135%, 19.15 at 20.91%, 18.20 at 21.13%, 2.76 at 3.21% and of 8.54 at 10.14% respectively for water capacity absorption, solubility index, gel length, ash and humidity. The results of this study indicated that storage susceptibility, chemical and functional properties of B. G. be dependant to the varieties.

Efeito da irrigação sobre o potencial fisiológico de sementes de soja em semeadura de inverno

Período seco e temperaturas amenas são condições climáticas ideais durante a maturação e colheita de sementes de soja. O objetivo foi verificar o efeito da irrigação no período pós-maturidade fisiológica, sobre o potencial fisiológico de sementes de soja semeadas no inverno. A disposição dos tratamentos seguiu esquema fatorial envolvendo três cultivares (IAC-19, Conquista e IAC 8-2) e duas épocas de interrupção da irrigação (início do estádio R7 e irrigação até 14 dias após R8). Foram feitas amostragens (colheitas) no início do estádio R7, 3, 7, 10, 14 (estádio R8) e 28 dias após o início do estádio R7. Para as avaliações utilizaram-se os testes de germinação, de envelhecimento acelerado e de condutividade elétrica e determinou-se a porcentagem de sementes manchadas e defeituosas. Nas condições em que foi realizado o experimento, concluiu-se que a irrigação após o estádio R7 não compromete e pode até melhorar o potencial fisiológico das sementes produzidas; a produção de sementes de soja em semeadura de inverno é possível em função de condições climáticas favoráveis.