50 resultados para Multi-extremal Objective Function
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
The autonomic nervous system maintains homeostasis, which is the state of balance in the body. That balance can be determined simply and noninvasively by evaluating heart rate variability (HRV). However, independently of autonomic control of the heart, HRV can be influenced by other factors, such as respiratory parameters. Little is known about the relationship between HRV and spirometric indices. In this study, our objective was to determine whether HRV correlates with spirometric indices in adults without cardiopulmonary disease, considering the main confounders (e.g., smoking and physical inactivity). In a sample of 119 asymptomatic adults (age 20-80 years), we evaluated forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV1). We evaluated resting HRV indices within a 5-min window in the middle of a 10-min recording period, thereafter analyzing time and frequency domains. To evaluate daily physical activity, we instructed participants to use a triaxial accelerometer for 7 days. Physical inactivity was defined as <150 min/week of moderate to intense physical activity. We found that FVC and FEV1, respectively, correlated significantly with the following aspects of the RR interval: standard deviation of the RR intervals (r =0.31 and 0.35), low-frequency component (r =0.38 and 0.40), and Poincaré plot SD2 (r =0.34 and 0.36). Multivariate regression analysis, adjusted for age, sex, smoking, physical inactivity, and cardiovascular risk, identified the SD2 and dyslipidemia as independent predictors of FVC and FEV1 (R2=0.125 and 0.180, respectively, for both). We conclude that pulmonary function is influenced by autonomic control of cardiovascular function, independently of the main confounders.
Resumo:
In Brazil, the largest producer of sugarcane in the world, the industrial process transforms this crop into ethanol and/or granulated sugar. Some cultivars exhibit enzymatic browning in the extracted sugarcane juice at levels harmful to the manufacturing process of white granulated sugar. The objective of this study was to assess the effect of sugarcane straw used as soil coverage, the use of different planting systems, and treatments with hydrogel polymer on enzymatic activity. The cultivar RB 86 7515 was sampled for 8 months; the first sample was obtained by cutting the upper portion of the stalk at the internode, which was taken to the laboratory for determination of the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The soil coverage with different forms of straw as well as the planting systems did not change the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The polyphenoloxidase (PPO) activity increased with the use of a polymer due to increased polyphenoloxidase (PPO) activity in the groove system. The enzymes studied showed changes in activity during the experimental period. The production of sugar at the end of the season (August to November) avoids the periods of highest enzymatic activity.
Resumo:
INTRODUCTION: Cardiovascular disease (CVD) is a major determinant of mortality in renal transplant recipients (RTR). Metabolic syndrome (MS) and chronic inflammation are currently considered non traditional risk factors for cardiovascular disease. This study evaluates the frequency of these conditions their associations with graft function. OBJECTIVE: To evaluate the prevalence of metabolic syndrome (MS) and inflammation and their associations with graft function in renal transplant recipients. METHODS: A cross-sectional study was carried out with 200 RTR. MS was defined by the NCEP-ATP III criteria. Inflammation was assessed by CRP levels. Renal function was assessed by GFR estimation using the MDRD equation. RESULTS: MS occurred in 71 patients (35.5%). Patients with MS had higher CPR and decreased GFR levels. Inflammation was present in 99 patients (49.5%). Mean waist perimeter, body mass index, triglycerides and serum total cholesterol were significantly higher in inflamed patients. An association between MS and inflammation was demonstrated, 48 (67.6%) patients with MS were inflamed and among those without MS the rate of inflamed patients was 39.5% (51 patients) (p < 0.001). A significantly higher percentage of patients with MS in the group of patients in chronic renal disease stages III and IV was observed. CONCLUSION: In RTR there is a significant association among MS and inflammation. MS is negatively associated with graft function. The clinical implications of these findings must be evaluated in longitudinal studies.
Resumo:
Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.