121 resultados para Interferon-gamma -- immunology
Resumo:
Multinucleated giant cells (MGC) are cells present in characteristic granulomatous inflammation induced by intracellular infectious agents or foreign materials. The present study evaluated the modulatory effect of granulocyte macrophage colony-stimulating factor (GM-CSF) in association with other cytokines such as interferon-gamma (IFN-γ), tumour necrosis factor-alpha, interleukin (IL)-10 or transforming growth factor beta (TGF-β1) on the formation of MGC from human peripheral blood monocytes stimulated with Paracoccidioides brasiliensis antigen (PbAg). The generation of MGC was determined by fusion index (FI) and the fungicidal activity of these cells was evaluated after 4 h of MGC co-cultured with viable yeast cells of P. brasiliensis strain 18 (Pb18). The results showed that monocytes incubated with PbAg and GM-CSF plus IFN-γ had a significantly higher FI than in all the other cultures, while the addition of IL-10 or TGF-β1 had a suppressive effect on MGC generation. Monocytes incubated with both pro and anti-inflammatory cytokines had a higher induction of foreign body-type MGC rather than Langhans-type MGC. MGC stimulated with PbAg and GM-CSF in association with the other cytokines had increased fungicidal activity and the presence of GM-CSF also partially inhibited the suppressive effects of IL-10 and TGF-β1. Together, these results suggest that GM-CSF is a positive modulator of PbAg-stimulated MGC generation and on the fungicidal activity against Pb18.
Resumo:
Schistosoma mansoni infection or associated products are able to down-modulate the type 1 CD4+ T cell inflammatory response characteristic of autoimmune diseases. In this study, we evaluated how S. mansoni antigens altered the immune response that was induced by the soluble Leishmania antigen (SLA) from cutaneous leishmaniasis (CL) patients. Cytokines were measured from the supernatants of peripheral blood mononuclear cell cultures stimulated with SLA. This was performed using the sandwich enzyme linked immunosorbent assay technique in the presence or absence of S. mansoni recombinant antigens Sm29, SmTSP-2 and PIII. The addition of S. mansoni antigens to the cultures resulted in the reduction of interferon gamma (IFN-γ) levels in 37-50% of patients. Although to a lesser extent, the antigens were also able to decrease the production of tumour necrosis factor-alpha (TNF-α). We compared patients that either had or did not have reduction in IFN-γ and TNF-α production in cultures stimulated with SLA in the presence of S. mansoni antigens. We found that there was no significant difference in the levels of interleukin (IL)-10 and IL-5 in response to S. mansoni antigens between the groups. The antigens used in this study down-modulated the in vitro proinflammatory response induced by SLA in a group of CL patients through a currently undefined mechanism.
Resumo:
A high prevalence of occult hepatitis B (OHB) genotype H infections has been observed in the native Mexican Nahua population. In addition, a low incidence of hepatitis B virus (HBV)-associated hepatocellular carcinoma has been described in Mexico. The immune response to infection among OHB-infected patients has been poorly evaluated in vivo. Therefore, we assessed the expression profiles of 23 cytokines in OHB genotype H-infected Nahua patients. A total of 41 sera samples from natives of the Nahua community were retrospectively analysed. Based on their HBV antibody profiles, patients were stratified into two groups: OHB patients (n = 21) and patients that had recovered from HBV infection (n = 20). Herein, we report distinctive cytokines profiles in OHB-infected individuals. Compared to healthy controls (n = 20) and patients who resolved HBV infection, OHB-infected patients displayed an increase in interleukin (IL)-2 secretion in addition to a characteristic inflammation profile (decrease in IL-8 and tumour necrosis factor-alpha levels and increased levels of tumour growth factor-beta). IL-15 and interferon-gamma levels were reduced in OHB-infected individuals when compared to those patients who resolved HBV infection. In contrast, OHB patients showed an increase in monocyte chemoattractant protein (MCP)-1 and MCP-2 compared to healthy controls and patients who resolved HBV infection. These findings suggest that cytokine expression can influence the severity of OHB disease and could lead to new investigation into the treatment of liver and other infectious diseases.
Resumo:
Trypanosoma cruzi infection induces progressive cardiac inflammation that leads to fibrosis and modifications in the heart architecture and functionality. Statins, such as 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase inhibitors, have been studied due to their pleiotropic roles in modulating the inflammatory response. Our goal was to evaluate the effects of simvastatin on the cardiac inflammatory process using a cardiotropic strain of T. cruzi in a murine model of Chagas cardiomyopathy. C57BL/6 mice were infected with 500 trypomastigotes of the Colombian strain of T. cruzi and treated with an oral dose of simvastatin (20 mg/Kg/day) for one month and inflammatory and morphometric parameters were subsequently evaluated in the serum and in the heart, respectively. Simvastatin reduced the total cholesterol and inflammatory mediators (interferon-gamma, tumour necrosis factor-alpha, CCL2 and CCL5) in the serum and in the heart tissue at 30 days post-infection. Additionally, a proportional reduction in heart weight and inflammatory infiltration was observed. Simvastatin also reduced epimastigote proliferation in a dose-dependent manner in vitro and was able to reduce blood trypomastigotes and heart amastigote nests during the acute phase of Chagas disease in vivo. Based on these data, we conclude that simvastatin exerts a modulatory effect on the inflammatory mediators that are elicited by the Colombian strain of T. cruzi and ameliorates the heart damage that is observed in a murine model of Chagas disease.
Resumo:
Resistance to Trypanosoma cruzi infections is critically dependent on cytokine-mediated activation of cell-mediated immune effector mechanisms. This review focuses on the role of IL-10, TNF-a, IFN-g and IL-12 in controlling T. cruzi replication by the innate and specific immune systems of the vertebrate host. A study performed on mice with disrupted recombinase-activating genes (RAG/KO), which lack T and B lymphocytes, revealed the importance of IL-12, IFN-g and TNF-a in the resistance against T. cruzi mediated by the innate immune system. In addition, data from experiments using IL-10 KO, RAG/KO and double RAG/IL-10 KO mice indicating an in vivo regulatory role of IL-10 in innate and T. cruzi-specific immunity are discussed
Resumo:
It has been shown that HLA class I molecules play a significant role in the regulation of the proliferation of T cells activated by mitogens and antigens. We evaluated the ability of mAb to a framework determinant of HLA class I molecules to regulate T cell proliferation and interferon gamma (IFN-g) production against leishmania, PPD, C. albicans and tetanus toxoid antigens in patients with tegumentary leishmaniasis and healthy subjects. The anti-major histocompatibility complex (MHC) mAb (W6/32) suppressed lymphocyte proliferation by 90% in cultures stimulated with aCD3, but the suppression was variable in cultures stimulated with leishmania antigen. This suppression ranged from 30-67% and was observed only in 5 of 11 patients. IFN-g production against leishmania antigen was also suppressed by anti-HLA class I mAb. In 3 patients IFN-g levels were suppressed by more than 60%, while in the other 2 cultures IFN-g levels were 36 and 10% lower than controls. The suppression by HLA class I mAb to the proliferative response in leishmaniasis patients and in healthy controls varied with the antigens and the patients or donors tested. To determine whether the suppression is directed at antigen presenting cells (APCs) or at the responding T cells, experiments with antigen-primed non-adherent cells, separately incubated with W6/32, were performed. Suppression of proliferation was only observed when the W6/32 mAb was added in the presence of T cells. These data provide evidence that a mAb directed at HLA class I framework determinants can suppress proliferation and cytokine secretion in response to several antigens.
Resumo:
Although the role of interleukin-2 (IL-2) and interferon gamma (gIFN) is still poorly understood in hyperthyroid diseases, it is reasonable to assume that these cytokines may be present at higher levels in Graves' disease (GD) than in other primarily non-autoimmune thyroid diseases. In order to look for an easy method to distinguish GD from primarily non-autoimmune causes of hyperthyroidism, we compared 13 healthy individuals with 21 treated and untreated hyperthyroid GD patients and with 19 patients with hyperthyroidism due to other etiologies: 7 cases of multinodular goiter, 5 cases of excessive hormone replacement and 7 cases of amiodarone-associated hyperthyroidism. All patients presented low TSH levels and a dubious clinical thyroid state. We found a good correlation between TSH and serum IL-2 levels (r = 0.56; P<0.01). Serum IL-2 (P<0.01) and gIFN (P<0.01) levels were lower in the hyperthyroid group of patients than in control subjects, suggesting a depressed TH1 pattern in the T-cell subset of hyperthyroid patients. GD had normal IL-2 levels, while patients with other forms of thyrotoxicosis presented decreased IL-2 levels (P<0.05). There was no difference between treated and untreated GD patients. We suggest that the direct measurement of serum IL-2 level may help to confirm hyperthyroidism caused by GD.
Resumo:
The gut mucosa is a major site of contact with antigens from food and microbiota. Usually, these daily contacts with natural antigens do not result in inflammatory reactions; instead they result in a state of systemic hyporesponsiveness named oral tolerance. Inflammatory bowel diseases (IBD) are associated with the breakdown of the immunoregulatory mechanisms that maintain oral tolerance. Several animal models of IBD/colitis are available. In mice, these include targeted disruptions of the genes encoding cytokines, T cell subsets or signaling proteins. Colitis can also be induced by intrarectal administration of chemical substances such as 2,4,6-trinitrobenzene sulfonic acid in 50% ethanol. We report here a novel model of colitis induced by intrarectal administration of 50% ethanol alone. Ethanol-treated mice develop an inflammatory reaction in the colon characterized by an intense inflammatory infiltrate in the mucosa and submucosa of the large intestine. They also present up-regulation of both interferon gamma (IFN-gamma) and interleukin-4 (IL-4) production by cecal lymph node and splenic cells. These results suggest a mixed type of inflammation as the substrate of the colitis. Interestingly, cells from mesenteric lymph nodes of ethanol-treated mice present an increase in IFN-gamma production and a decrease in IL-4 production indicating that the cytokine balance is altered throughout the gut mucosa. Moreover, induction of oral tolerance to ovalbumin is abolished in these animals, strongly suggesting that ethanol-induced colitis interferes with immunoregulatory mechanisms in the intestinal mucosa. This novel model of colitis resembles human IBD. It is easy to reproduce and may help us to understand the mechanisms involved in IBD pathogenesis.
Resumo:
Induced oral tolerance to mucosal-exposed antigens in immunized animals is of particular interest for the development of immunotherapeutic approaches to human allergic diseases. This is a unique feature of mucosal surfaces which represent the main contact interface with the external environment. However, the influence of oral tolerance on specific and natural polyreactive IgA antibodies, the major defense mechanism of the mucosa, is unknown. We have shown that oral administration of an extract of the dust mite Dermatophagoides pteronyssinus (Dp) to primed mice caused down-regulation of IgE responses and an increase in tumor growth factor-ß secretion. In the present study, we observed that primed inbred female A/Sn mice (8 to 10 weeks old) fed by gavage a total weight of 1.0-mg Dp extract on the 6th, 7th and 8th days post-immunization presented normal secretion of IL-4 and IL-10 in gut-associated lymphoid tissue and a decreased production of interferon gamma induced by Dp in the draining lymph nodes (13,340 ± 3,519 vs 29,280 ± 2,971 pg/ml). Mice fed the Dp extract also showed higher levels of serum anti-Dp IgA antibodies and an increase of IgA-secreting cells in mesenteric lymph nodes (N = 10), reflecting an increase in total fecal IgA antibodies (N = 10). The levels of secretory anti-Dp IgA antibodies increased after re-immunization regardless of Dp extract feeding. Oral tolerance did not interfere with serum or secretory IgA antibody reactivity related to self and non-self antigens. These results suggest that induction of oral tolerance to a Dp extract in sensitized mice triggered different regulatory mechanisms which inhibited the IgE response and stimulated systemic and secretory IgA responses, preserving the natural polyreactive IgA antibody production.
Resumo:
Several primary immunodeficiency diseases affecting the interleukin 12/interferon gamma (IFN-gamma) pathway have been identified, most of them characterized by recurrent and protracted infections produced by intracellular microorganisms, particularly by several species of mycobacteria. In the present study we analyzed the expression of IFN-gamma receptor (IFN-gammaR) and signal transducer and activator of transcription 1 (STAT-1) in 4 children with Mycobacterium tuberculosis infection of uncommon clinical presentation. These molecules were evaluated by flow cytometry and Western blotting in B cells transformed with Epstein-Barr virus and mutations were scanned by single-strand conformational polymorphisms and DNA sequencing. The expression of IFN-gammaR1 was normal in all 4 patients. The genetic analysis of IFN-gammaR1 and IFN-gammaR2 coding sequences did not reveal any mutation. The expression of the STAT-1 molecule was similar in patients and healthy controls; however, when the phosphorylation of this transcription factor in response to IFN-gamma activation was evaluated by Western blot, a significant lower signal was evident in one patient. These data indicate that there are no alterations in the expression or function of the IFN-gammaR chains in these patients. However, the low level of STAT-1 phosphorylation found in one of these patients might be explained by a defect in one of the molecules involved in the signal transduction pathway after IFN-gamma interacts with its receptor. In the other three patients the inability to eliminate the mycobacteria may be due to a defect in another effector mechanism of the mononuclear phagocytes.
Resumo:
Wheezing associated with respiratory viral infections in infancy is very common and results in high morbidity worldwide. The Th1/Th2 pattern of immune response in these patients remains unclear and previous studies have shown controversial results. The aim of the present study was to compare the type of Th1/Th2 cytokine response between infants with acute bronchiolitis, recurrent wheezing and upper respiratory infections from a developing country. Infants younger than 2 years of age admitted to Hospital São Lucas, Porto Alegre, RS, Brazil, between May and November 2001, with an acute episode of wheezing associated with viral respiratory infection were selected. Subjects with upper respiratory infections from the emergency department were selected for the control group. Interferon-gamma (IFN-gamma) and interleukin-4 (IL-4) levels from nasal aspirates were determined by ELISA from peripheral mononuclear cell cultures. Twenty-nine subjects with acute bronchiolitis, 18 with recurrent wheezing and 15 with upper respiratory infections were enrolled. There were no differences in family history of atopy or parental smoking between groups. Oxygen requirement was similar for the acute bronchiolitis and recurrent wheezing groups. The percentage of positive tests for the cytokines studied and the IFN-gamma/IL-4 ratio was similar for all groups. Comparison of the polarized Th1/Th2 cytokine results for the various groups showed no specific pattern of cytokine production. Infants with wheezing from a developing country do not show any specific predominant pattern of Th1/Th2 cytokine production, suggesting that multiple factors may be involved in the pathogenesis of this illness.
Resumo:
Susceptibility to experimental autoimmune uveitis (EAU) in inbred mice has been associated with a dominant Th1 response. Elevated anti-inter-photoreceptor retinoid-binding protein (anti-IRBP) IgG2a/IgG1 antibody ratios have been implicated as candidate markers to predict disease severity. In the present study, both the anti-IRBP antibody isotype and severity of EAU phenotypes were examined in 4 non-isogenic genetically selected mouse lines to determine if they can be used as general markers of disease. Mice between 8 and 12 weeks old selected for high (H III) or low (L III) antibody response and for maximum (AIR MAX) or minimum (AIR MIN) acute inflammatory reaction (AIR) were immunized with IRBP. Each experiment was performed with at least 5 mice per group. EAU was evaluated by histopathology 21 days after immunization and the minimal criterion was inflammatory cell infiltration of the ciliary body, choroid and retina. Serum IgG1- and IgG2a-specific antibodies were determined by ELISA. EAU was graded by histological examination of the enucleated eyes. The incidence of EAU was lower in AIR MIN mice whereas in the other strains approximately 40% of the animals developed the disease. Low responder animals did not produce anti-IRBP IgG2a antibodies or interferon-gamma. No correlation was observed between susceptibility to EAU and anti-IRBP isotype profiles. Susceptibility to EAU is related to the intrinsic capacity to mount higher inflammatory reactions and increased production of anti-IRBP IgG2a isotype is not necessarily a marker of this immunologic profile.
Resumo:
Our objective was to determine lipid peroxidation and nuclear factor-κB (NF-κB) activation in skeletal muscle and the plasma cytokine profile following maximum progressive swimming. Adult male Swiss mice (N = 15) adapted to the aquatic environment were randomly divided into three groups: immediately after exercise (EX1), 3 h after exercise (EX2) and control. Animals from the exercising groups swam until exhaustion, with an initial workload of 2% of body mass attached to the tail. Control mice did not perform any exercise but were kept immersed in water for 20 min. Maximum swimming led to reactive oxygen species (ROS) generation in skeletal muscle, as indicated by increased thiobarbituric acid reactive species (TBARS) levels (4062.67 ±1487.10 vs 19,072.48 ± 8738.16 nmol malondialdehyde (MDA)/mg protein, control vs EX1). Exercise also promoted NF-κB activation in soleus muscle. Cytokine secretion following exercise was marked by increased plasma interleukin-6 (IL-6) levels 3 h post-exercise (P < 0.05). Interleukin-10 (IL-10) levels were reduced following exercise and remained reduced 3 h post-exercise (P < 0.05). Plasma levels of other cytokines investigated, monocyte chemotactic protein-1 (MCP-1), tumor necrosis factor-alpha (TNF-α), interferon-gamma (IFN-γ) and interleukin-12 (IL-12), were not altered by exercise. The present findings showed that maximum swimming, as well as other exercise models, led to lipid peroxidation and NF-κB activation in skeletal muscle and increased plasma IL-6 levels. The plasma cytokine response was also marked by reduced IL-10 levels. These results were attributed to exercise type and intensity.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.