59 resultados para Human form (face and body). Life studies
Resumo:
The vasorelaxant effects of SR 47063 (4-(2-cyanimino-1,2-dihydropyrid-1-yl)-2,2-dimethyl-6-nitrochromene), a new K+-channel opener structurally related to levcromakalim, were examined in isolated human saphenous vein (HSV) and rat aorta (RA). HSV or RA rings were precontracted with either KCl or noradrenaline and cumulative relaxant concentration-response curves were obtained for SR 47063 (0.1 nM to 1 µM) in the presence or absence of 3 µM glibenclamide. SR 47063 potently relaxed HSV and RA precontracted with 20 mM (but not 60 mM) KCl or 10 µM noradrenaline in a concentration-dependent manner, showing slightly greater activity in the aorta. The potency of the effect of SR 47063 on HSV and RA was 12- and 58-fold greater, respectively, than that reported for the structurally related K+-channel opener levcromakalim. The vasorelaxant action of SR 47063 in both blood vessels was strongly inhibited by 3 µM glibenclamide, consistent with a mechanism of action involving ATP-dependent K+-channels.
Resumo:
In order to assess the relative influence of age, resting heart rate (HR) and sedentary life style, heart rate variability (HRV) was studied in two different groups. The young group (YG) consisted of 9 sedentary subjects aged 15 to 20 years (YG-S) and of 9 nonsedentary volunteers (YG-NS) also aged 15 to 20. The elderly sedentary group (ESG) consisted of 16 sedentary subjects aged 39 to 82 years. HRV was assessed using a short-term procedure (5 min). R-R variability was calculated in the time-domain by means of the root mean square successive differences. Frequency-domain HRV was evaluated by power spectrum analysis considering high frequency and low frequency bands. In the YG the effort tolerance was ranked in a bicycle stress test. HR was similar for both groups while ESG showed a reduced HRV compared with YG. Within each group, HRV displayed a negative correlation with HR. Although YG-NS had better effort tolerance than YG-S, their HR and HRV were not significantly different. We conclude that HRV is reduced with increasing HR or age, regardless of life style. The results obtained in our short-term study agree with others of longer duration by showing that age and HR are the main determinants of HRV. Our results do not support the idea that changes in HRV are related to regular physical activity.
Resumo:
The time course of heart rate and body weight alterations during the natural period of dormancy were determined in active feeding and dormant juvenile specimens of Megalobulimus sanctipauli. In both groups, heart rate markedly decreased during the first 40 days of dormancy, tending to stabilize thereafter. This time period coincided with the decrease in environmental temperature during autumn-winter. At the end of the dormancy period, surviving active feeding and dormant snails showed a significant decrease in heart rate which, however, was significantly greater in the latter group. Total body weight decreased concomitantly with heart rate in dormant snails but remained constant in active feeding snails. Body hydration induced significant increases in weight and heart rate in surviving dormant snails. Feeding following hydration promoted a new significant increase in heart rate but not in weight. These results indicate that the decrease in heart rate observed in juvenile specimens of M. sanctipauli during dormancy may be due to at least three factors: 1) decrease in environmental temperature during autumn-winter, 2) starvation which leads to the depletion of endogenous fuel reserves and to a probable decrease in hemolymph nutrient levels, and 3) dehydration which leads to a probable decrease in hemolymph volume and venous return and/or to an increase in hemolymph osmolarity.
Resumo:
The influence of chronic nitric oxide synthase inhibition with N G-nitro-L-arginine methyl ester (L-NAME) on body fluid distribution was studied in male Wistar rats weighing 260-340 g. Extracellular, interstitial and intracellular spaces, as well as plasma volume were measured after a three-week treatment with L-NAME (~70 mg/kg per 24 h in drinking water). An increase in extracellular space (16.1 ± 1.1 vs 13.7 ± 0.6 ml/100 g in control group, N = 12, P<0.01), interstitial space (14.0 ± 0.9 vs 9.7 ± 0.6 ml/100 g in control group, P<0.001) and total water (68.7 ± 3.9 vs 59.0 ± 2.9 ml/100 g, P<0.001) was observed in the L-NAME group (N = 8). Plasma volume was lower in L-NAME-treated rats (2.8 ± 0.2 ml/100 g) than in the control group (3.6 ± 0.1 ml/100 g, P<0.001). Blood volume was also lower in L-NAME-treated rats (5.2 ± 0.3 ml/100 g) than in the control group (7.2 ± 0.3 ml/100 g, P<0.001). The increase in total ratio of kidney wet weight to body weight in the L-NAME group (903 ± 31 vs 773 ± 45 mg/100 g in control group, P<0.01) but not in total kidney water suggests that this experimental hypertension occurs with an increase in renal mass. The fact that the heart weight to body weight ratio and the total heart water remained constant indicates that, despite the presence of high blood pressure, no modification in cardiac mass occurred. These data show that L-NAME-induced hypertension causes alterations in body fluid distribution and in renal mass.
Resumo:
In the present paper we discuss the development of "wave-front", an instrument for determining the lower and higher optical aberrations of the human eye. We also discuss the advantages that such instrumentation and techniques might bring to the ophthalmology professional of the 21st century. By shining a small light spot on the retina of subjects and observing the light that is reflected back from within the eye, we are able to quantitatively determine the amount of lower order aberrations (astigmatism, myopia, hyperopia) and higher order aberrations (coma, spherical aberration, etc.). We have measured artificial eyes with calibrated ametropia ranging from +5 to -5 D, with and without 2 D astigmatism with axis at 45º and 90º. We used a device known as the Hartmann-Shack (HS) sensor, originally developed for measuring the optical aberrations of optical instruments and general refracting surfaces in astronomical telescopes. The HS sensor sends information to a computer software for decomposition of wave-front aberrations into a set of Zernike polynomials. These polynomials have special mathematical properties and are more suitable in this case than the traditional Seidel polynomials. We have demonstrated that this technique is more precise than conventional autorefraction, with a root mean square error (RMSE) of less than 0.1 µm for a 4-mm diameter pupil. In terms of dioptric power this represents an RMSE error of less than 0.04 D and 5º for the axis. This precision is sufficient for customized corneal ablations, among other applications.
Resumo:
Children with chronic renal failure in general present growth retardation that is aggravated by corticosteroids. We describe here the effects of methylprednisolone (MP) and recombinant human growth hormone (rhGH) on the growth plate (GP) of uremic rats. Uremia was induced by subtotal nephrectomy in 30-day-old rats, followed by 20 IU kg-1 day-1 rhGH (N = 7) or 3 mg kg-1 day-1 MP (N = 7) or 20 IU kg-1 day-1 rhGH + 3 mg kg-1 day-1 MP (N = 7) treatment for 10 days. Control rats with intact renal function were sham-operated and treated with 3 mg kg-1 day-1 MP (N = 7) or vehicle (N = 7). Uremic rats (N = 7) were used as untreated control animals. Structural alterations in the GP and the expression of anti-proliferating cell nuclear antigen (PCNA) and anti-insulin-like growth factor I (IGF-I) by epiphyseal chondrocytes were evaluated. Uremic MP rats displayed a reduction in the proliferative zone height (59.08 ± 4.54 vs 68.07 ± 7.5 µm, P < 0.05) and modifications in the microarchitecture of the GP. MP and uremia had an additive inhibitory effect on the proliferative activity of GP chondrocytes, lowering the expression of PCNA (19.48 ± 11.13 vs 68.64 ± 7.9% in control, P < 0.0005) and IGF-I (58.53 ± 0.96 vs 84.78 ± 2.93% in control, P < 0.0001), that was counteracted by rhGH. These findings suggest that in uremic rats rhGH therapy improves longitudinal growth by increasing IGF-I synthesis in the GP and by stimulating chondrocyte proliferation.
Resumo:
Our objective was to determine if automated peritoneal dialysis (APD) leads to changes in nutritional parameters of patients treated by continuous ambulatory peritoneal dialysis (CAPD). Twenty-six patients (15 males; 50.5 ± 14.3 years) were evaluated during CAPD while training for APD and after 3 and 6 months of APD. Body fat was assessed by the sum of skinfold thickness and the other body compartments were assessed by bioelectrical impedance. During the 6-month follow-up, 12 patients gained more than 1 kg (GW group), 8 patients lost more than 1 kg (LW group), and 6 patients maintained body weight (MW group). Except for length on dialysis that was longer for the LW group compared with the GW group, no other differences were found between the groups at baseline. After 6 months on APD, the LW group had a reduction in body fat (24.5 ± 7.7 vs 22.1 ± 7.3 kg; P = 0.01), body cell mass (22.6 ± 6.2 vs 21.6 ± 5.8 kg, P = 0.02) and phase angle (5.4 ± 0.9 vs 5.1 ± 0.8 degrees, P = 0.004). In the GW group, body fat (25 ± 7.6 vs 27.2 ± 7.6 kg, P = 0.001) and body cell mass (20.1 ± 3.9 vs 20.8 ± 4.0 kg, P = 0.05) were increased. In the present study, different patterns of change in body composition were found. The length of previous dialysis treatment seems to be the most important factor in determining these nutritional modifications.
Resumo:
We assessed the 6-min walk distance (6MWD) and body weight x distance product (6MWw) in healthy Brazilian subjects and compared measured 6MWD with values predicted in five reference equations developed for other populations. Anthropometry, spirometry, reported physical activity, and two walk tests in a 30-m corridor were evaluated in 134 subjects (73 females, 13-84 years). Mean 6MWD and 6MWw were significantly greater in males than in females (622 ± 80 m, 46,322 ± 10,539 kg.m vs 551 ± 71 m, 36,356 ± 8,289 kg.m, P < 0.05). Four equations significantly overestimated measured 6MWD (range, 32 ± 71 to 137 ± 74 m; P < 0.001), and one significantly underestimated it (-36 ± 86 m; P < 0.001). 6MWD significantly correlated with age (r = -0.39), height (r = 0.44), body mass index (r = -0.24), and reported physical activity (r = 0.25). 6MWw significantly correlated with age (r = -0.21), height (r = 0.66) and reported physical activity (r = 0.25). The reference equation devised for walk distance was 6MWDm = 622.461 - (1.846 x Ageyears) + (61.503 x Gendermales = 1; females = 0); r2 = 0.300. In an additional group of 85 subjects prospectively studied, the difference between measured and the 6MWD predicted with the equation proposed here was not significant (-3 ± 68 m; P = 0.938). The measured 6MWD represented 99.6 ± 11.9% of the predicted value. We conclude that 6MWD and 6MWw variances were adequately explained by demographic and anthropometric attributes. This reference equation is probably most appropriate for evaluating the exercise capacity of Brazilian patients with chronic diseases.
Resumo:
Ginkgo biloba extract (GbE) has been indicated as an efficient medicine for the treatment of diabetes mellitus type 2. It remains unclear if its effects are due to an improvement of the insulin signaling cascade, especially in obese subjects. The aim of the present study was to evaluate the effect of GbE on insulin tolerance, food intake, body adiposity, lipid profile, fasting insulin, and muscle levels of insulin receptor substrate 1 (IRS-1), protein tyrosine phosphatase 1B (PTP-1B), and protein kinase B (Akt), as well as Akt phosphorylation, in diet-induced obese rats. Rats were fed with a high-fat diet (HFD) or a normal fat diet (NFD) for 8 weeks. After that, the HFD group was divided into two groups: rats gavaged with a saline vehicle (HFD+V), and rats gavaged with 500 mg/kg of GbE diluted in the saline vehicle (HFD+Gb). NFD rats were gavaged with the saline vehicle only. At the end of the treatment, the rats were anesthetized, insulin was injected into the portal vein, and after 90s, the gastrocnemius muscle was removed. The quantification of IRS-1, Akt, and Akt phosphorylation was performed using Western blotting. Serum levels of fasting insulin and glucose, triacylglycerols and total cholesterol, and LDL and HDL fractions were measured. An insulin tolerance test was also performed. Ingestion of a hyperlipidic diet promoted loss of insulin sensitivity and also resulted in a significant increase in body adiposity, plasma triacylglycerol, and glucose levels. In addition, GbE treatment significantly reduced food intake and body adiposity while it protected against hyperglycemia and dyslipidemia in diet-induced obesity rats. It also enhanced insulin sensitivity in comparison to HFD+V rats, while it restored insulin-induced Akt phosphorylation, increased IRS-1, and reduced PTP-1B levels in gastrocnemius muscle. The present findings suggest that G. biloba might be efficient in preventing and treating obesity-induced insulin signaling impairment.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
This study analyzed the variation in shape and size of Adzuki beans during soaking at different temperatures. In addition, different mathematical models were fitted to the experimental values of volumetric expansion, selecting the best one. Grains of Adzuki beans (Vigna angularis) with moisture content of approximately 0.25 (decimal d.b.) were manually harvested; they were, then, dried to 0.128 (decimal d.b.). The beans were subjected to soaking in distilled water at the temperatures 18 ± 1, 27 ± 1, 36 ± 1, and 45 ± 1 °C, in five repetitions. Recipients containing 80 mL of distilled water and 20 g of beans for each sample were used. The samples were periodically weighed in order to determine the water absorption. After that, the samples were removed from the recipients and placed on filter papers for two minutes to drain the surface water. Water absorption continued until the beans reached the saturation moisture content. It was concluded that, the form of the Adzuki beans was altered regularly, the orthogonal axes expanded differentially in the radial and axial directions, and that the linear model appropriately described the volumetric expansion of the Adzuki beans, among the series of models analyzed for the temperatures 18, 27, 36 and 45 °C.
Resumo:
Covering the grapevine rows to delay the maturity and harvest date became widely practiced in 'Sultana Seedless' vineyards. The research work was conducted to test different cover materials (polypropylene cross-stitch, life pack, mogul and transparent polyethylene) in respect to their effects on grape quality and storability. Harvest was delayed for one month in covered plots. Harvested grapes were packed and transferred to storage rooms after pre-cooling. During packing, the grape clusters were sealed in PE bags with sulphur dioxide pads. The grapes were stored for 90 days in the first year and 120 days in the second year, at -0.5ºC and 90% RH. All the grape clusters were healthy and of marketable quality after 90 days of storage period. In the first year, at the end of the storage, only those grapes harvested from the rows covered with polypropylene cross-stitch showed fungal growth. The sensory quality scores revealed a lower level of preference after 120 days of storage. The effects of the covering materials tested were similar regarding grape quality and storage performance except the transparent polyethylene that damaged the grapevine leaves.
Resumo:
Abstract Fish consumption has increased in recent years. However, fish meat is highly perishable, which demonstrates the need for technologies to preserve its quality. Edible coatings (EC) might provide an alternative to extend the shelf life of fish. The goal of this study was to evaluate the effect of EC of chitosan (C) in combination with carvacrol (CAR) on the physical and microbiological changes of tilapia fillets. Fillets were submerged for two minutes in different treatments (T1: control; T2: C 2%; T3: C 2% + 0.125% CAR; T 4: C 2% + 0.25% CAR). At the end of storage, T1 and T2 showed the lowest values of total volatile bases (TVB). The color parameters L*, a* and b* varied from each treatment. The texture decreased and the different treatments reduced the microbial population in relation to the control; T3 and T4 were the most effective. These results show that the use of C with CAR might be an alternative method to preserve the quality and safety of tilapia fillets.
Resumo:
Abstract There are no precedents concerning the quality of Octopus maya during chilled storage. This study evaluated the shelf life of the red octopus in chilling storage (4oC) and the correlation of the sensory quality index with microbiological counting and the biochemical indicators (hypoxanthine, histamine and volatile amines). A total of 112 whole raw octopi (average weight of 896 g) were randomly selected from seven batches and exposed to 4°C for 18, 24, 48, 72, 84, 96, and 100 h. The histamine concentration (91.7%), followed by the counts of psychrotrophic bacteria (5.5%) and hypoxanthine (2.2%), were the predictors from the redundancy analysis that better explained the changes taking place during the chilling hours. After 72 h of chilling, the microbial count was determined to be log 4.7 CFU/g, and the octopus samples were classified as B quality (minor sensory quality defects) based on the sensory quality scale. Although the samples were not classified as unacceptable at 100 h of refrigeration by the sensory index, the level of histamine reached the defect action level (5 mg/100 g) as ruled by the International Food Safety Authorities. The shelf life of the red octopus in chilling storage was predicted to be 119 h.