51 resultados para Function of the publisher


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Discrepancy was found between enhanced hypotension and attenuated relaxation of conduit arteries in response to acetylcholine (ACh) and bradykinin (BK) in nitric oxide (NO)-deficient hypertension. The question is whether a similar phenomenon occurs in spontaneously hypertensive rats (SHR) with a different pathogenesis. Wistar rats, SHR, and SHR treated with NO donors [molsidomine (50 mg/kg) or pentaerythritol tetranitrate (100 mg/kg), twice a day, by gavage] were studied. After 6 weeks of treatment systolic blood pressure (BP) was increased significantly in experimental groups. Under anesthesia, the carotid artery was cannulated for BP recording and the jugular vein for drug administration. The iliac artery was used for in vitro studies and determination of geometry. Compared to control, SHR showed a significantly enhanced (P < 0.01) hypotensive response to ACh (1 and 10 µg, 87.9 ± 6.9 and 108.1 ± 5.1 vs 35.9 ± 4.7 and 64.0 ± 3.3 mmHg), and BK (100 µg, 106.7 ± 8.3 vs 53.3 ± 5.2 mmHg). SHR receiving NO donors yielded similar results. In contrast, maximum relaxation of the iliac artery in response to ACh was attenuated in SHR (12.1 ± 3.6 vs 74.2 ± 8.6% in controls, P < 0.01). Iliac artery inner diameter also increased (680 ± 46 vs 828 ± 28 µm in controls, P < 0.01). Wall thickness, wall cross-section area, wall thickness/inner diameter ratio increased significantly (P < 0.01). No differences were found in this respect among SHR and SHR treated with NO donors. These findings demonstrated enhanced hypotension and attenuated relaxation of the conduit artery in response to NO activators in SHR and in SHR treated with NO donors, a response similar to that found in NO-deficient hypertension.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Most adult tissues retain a reservoir of self-renewing, multipotent stem cells that can generate differentiated tissue components. Until recently, the brain was thought to be an exception to this rule and for many years the pervasive dogma of neurobiology relegated neurogenesis to the embryonic and earlier postnatal stages of development. The discovery of constant neuronal replacement in the adult brain has changed the way we think about neurological diseases and about the exploration of new strategies for brain repair. In this review we will explore the potential of adult neural stem cells and we will present some of our own work on this subject. We will also discuss the possibility that adult neurogenesis and neuronal replacement may also play a role in therapies aimed at restoring impaired brain function. A better understanding of the various aspects of spontaneous neuronal replacement may also be used to increase the success of procedures with cell therapies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Falls are a major concern in the elderly population with chronic joint disease. To compare muscular function and functional mobility among older women with knee osteoarthritis with and without a history of falls, 15 elderly women with a history of falls (74.20 ± 4.46 years) and 15 without a history of falls (71.73 ± 4.73 years) were studied. Muscular function, at the angular speed of 60, 120, and 180º/s, was evaluated using the Biodex Isokinetic Dynamometer. The sit-to-stand task was performed using the Balance Master System and the Timed Up and Go test was used to determine functional mobility. After collection of these data, the history of falls was investigated. A statistically significant difference was detected in the time taken to transfer the center of gravity during the sit-to-stand test (means ± SD; non-fallers: 0.35 ± 0.16 s; fallers: 0.55 ± 0.32 s; P = 0.049, Student t-test) and in the Timed Up and Go test (medians; non-fallers: 10.08 s; fallers: 11.59 s; P = 0.038, Mann-Whitney U-test). The results indicated that elderly osteoarthritic women with a history of falls presented altered functional mobility and needed more time to transfer the center of gravity in the sit-to-stand test. It is important to implement strategies to guarantee a better functional performance of elderly patients to reduce fall risks.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The maintenance of extracellular Na+ and Cl- concentrations in mammals depends, at least in part, on renal function. It has been shown that neural and endocrine mechanisms regulate extracellular fluid volume and transport of electrolytes along nephrons. Studies of sex hormones and renal nerves suggested that sex hormones modulate renal function, although this relationship is not well understood in the kidney. To better understand the role of these hormones on the effects that renal nerves have on Na+ and Cl- reabsorption, we studied the effects of renal denervation and oophorectomy in female rats. Oophorectomized (OVX) rats received 17β-estradiol benzoate (OVE, 2.0 mg·kg-1·day-1, sc) and progesterone (OVP, 1.7 mg·kg-1·day-1,sc). We assessed Na+ and Cl-fractional excretion (FENa+ and FECl-, respectively) and renal and plasma catecholamine release concentrations. FENa+, FECl-, water intake, urinary flow, and renal and plasma catecholamine release levels increased in OVX vs control rats. These effects were reversed by 17β-estradiol benzoate but not by progesterone. Renal denervation did not alter FENa+, FECl-, water intake, or urinary flow values vs controls. However, the renal catecholamine release level was decreased in the OVP (236.6±36.1 ng/g) and denervated rat groups (D: 102.1±15.7; ODE: 108.7±23.2; ODP: 101.1±22.1 ng/g). Furthermore, combining OVX + D (OD: 111.9±25.4) decreased renal catecholamine release levels compared to either treatment alone. OVE normalized and OVP reduced renal catecholamine release levels, and the effects on plasma catecholamine release levels were reversed by ODE and ODP replacement in OD. These data suggest that progesterone may influence catecholamine release levels by renal innervation and that there are complex interactions among renal nerves, estrogen, and progesterone in the modulation of renal function.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The timing and mechanisms of protection by hyperbaric oxygenation (HBO) in hypoxic-ischemic brain damage (HIBD) have only been partially elucidated. We monitored the effect of HBO on the mitochondrial function of neuronal cells in the cerebral cortex of neonatal rats after HIBD. Neonatal Sprague-Dawley rats (total of 360 of both genders) were randomly divided into normal control, HIBD, and HIBD+HBO groups. The HBO treatment began immediately after hypoxia-ischemia (HI) and continued once a day for 7 consecutive days. Animals were euthanized 0, 2, 4, 6, and 12 h post-HI to monitor the changes in mitochondrial membrane potential (ΔΨm) occurring soon after a single dose of HBO treatment, as well as 2, 3, 4, 5, 6, and 7 days post-HI to study ΔΨm changes after a series of HBO treatments. Fluctuations in ΔΨm were observed in the ipsilateral cortex in both HIBD and HIBD+HBO groups. Within 2 to 12 h after HI insult, the ΔΨm of the HIBD and HIBD+HBO groups recovered to some extent. A secondary drop in ΔΨm was observed in both groups during the 1-4 days post-HI period, but was more severe in the HIBD+HBO group. There was a secondary recovery of ΔΨm observed in the HIBD+HBO group, but not in the HIBD group, during the 5-7 days period after HI insult. HBO therapy may not lead to improvement of neural cell mitochondrial function in the cerebral cortex in the early stage post-HI, but may improve it in the sub-acute stage post-HI.