Topical application of a melanotropin analogue to vulgar vitiligo dermo-epidermal minigrafts

Human subjects with active vulgar vitiligo do not respond well to autologous dermo-epidermal minigrafting. Eighteen subjects were treated with the a-melanocyte-stimulating hormone (a-MSH) synthetic analogue [Nle4, D-Phe7]-a-MSH. The hormone (50 µl, 0.4 mM) was applied topically to 30-cm2 lesions in which 29-48 minigrafts had been made. The hormone did not improve the success of the minigrafting and no differences were observed in local or distant repigmentation in treated subjects as compared to the placebo group. Aliquots of 24-h urine concentrated by lyophilization irreversibly darkened toad skins, demonstrating the presence of the analogue. This is the first report of the transdermal delivery of a topically applied melanotropin in living human subjects.

Incorporation of dietary trans monounsaturated fatty acids into tissues of Walker 256 tumor-bearing rats

The correlation between dietary trans fatty acids and neoplasia was examined in the present study. Walker 256 tumor-bearing and control rats were fed a trans monounsaturated fatty acid (MUFA)-rich diet for 8 weeks and the incorporation of trans fatty acids by tumor tissue was examined. Also, the effect of tumor growth on trans fatty acid composition of plasma and liver, and the content of thiobarbituric acid-reactive substances (TBARS) was determined. Walker 256 tumor cells presented both trans and cis MUFAs given in the diet. The equivalent diet proportions were 0.66 for trans and 1.14 for cis. Taking into consideration the proportion of trans MUFAs in plasma (11.47%), the tumor incorporated these fatty acids in a more efficient manner (18.27%) than the liver (9.34%). Therefore, the dietary trans fatty acids present in the diet are actively incorporated by the tumor. Tumor growth itself caused marked changes in the proportion of polyunsaturated fatty acids in the plasma and liver but provoked only slight modifications in both trans and cis MUFAs. Tumor growth also reduced the unsaturation index in both plasma and liver, from 97.79 to 86.83 and from 77.51 to 69.64, respectively. This effect was partially related to an increase in the occurrence of the lipid oxidation/peroxidation process of TBARS content which was increased in both plasma (from 0.428 to 0.505) and liver (from 9.425 to 127.792) due to tumor growth.

The DNA puff BhB10-1 gene is differentially expressed in various tissues of Bradysia hygida late larvae and constitutively transcribed in transgenic Drosophila

We extended the characterization of the DNA puff BhB10-1 gene of Bradysia hygida by showing that, although its mRNA is detected only at the end of the fourth larval instar, BhB10-1 expression is not restricted to the salivary gland, the tissue in which this gene is amplified. Different amounts of BhB10-1 mRNA were detected in other larval tissues such as gut, Malpighian tubules, fat body, brain and cuticle, suggesting that this gene is expressed differentially in the various tissues analyzed. Analysis of transgenic Drosophila carrying the BhB10-1 transcription unit and flanking sequences revealed that the tested fragment promotes transcription in a constitutive manner. We suggest that either cis-regulatory elements are missing in the transgene or factors that temporally regulate the BhB10-1 gene in B. hygida are not conserved in Drosophila.

Influence of exercise on the activity and the distribution between free and bound forms of glycolytic and associated enzymes in tissues of horse mackerel

The effects of short-term burst (5 min at 1.8 m/s) swimming and long-term cruiser (60 min at 1.2 m/s) swimming on maximal enzyme activities and enzyme distribution between free and bound states were assessed for nine glycolytic and associated enzymes in tissues of horse mackerel, Trachurus mediterraneus ponticus. The effects of exercise were greatest in white muscle. The activities of phosphofructokinase (PFK), pyruvate kinase (PK), fructose-1,6-bisphosphatase (FBPase), and phosphoglucomutase (PGM) all decreased to 47, 37, 37 and 67%, respectively, during 60-min exercise and all enzymes except phosphoglucoisomerase (PGI) and PGM showed a change in the extent of binding to subcellular particulate fractions during exercise. In red muscle, exercise affected the activities of PGI, FBPase, PFK, and lactate dehydrogenase (LDH) and altered percent binding of only PK and LDH. In liver, exercise increased the PK activity 2.3-fold and reduced PGI 1.7-fold only after 5 min of exercise but altered the percent binding of seven enzymes. Fewer effects were seen in brain, with changes in the activities of aldolase and PGM and in percent binding of hexokinase, PFK and PK. Changes in enzyme activities and in binding interactions with subcellular particulate matter appear to support the altered demands of tissue energy metabolism during exercise.

Molecular characterization of DDX26, a human DEAD-box RNA helicase, located on chromosome 7p12

DEAD-box proteins comprise a family of ATP-dependent RNA helicases involved in several aspects of RNA metabolism. Here we report the characterization of the human DEAD-box RNA helicase DDX26. The gene is composed of 14 exons distributed over an extension of 8,123 bp of genomic sequence and encodes a transcript of 1.8 kb that is expressed in all tissues evaluated. The predicted amino acid sequence shows a high similarity to a yeast DEAD-box RNA helicase (Dbp9b) involved in ribosome biogenesis. The new helicase maps to 7p12, a region of frequent chromosome amplifications in glioblastomas involving the epidermal growth factor receptor (EGFR) gene. Nevertheless, co-amplification of DDX26 with EGFR was not detected in nine tumors analyzed.

Expression of CYP2A3 mRNA and its regulation by 3-methylcholanthrene, pyrazole, and ß-ionone in rat tissues

Cytochrome P450 (CYP) 2A enzymes are involved in the metabolism of numerous drugs and hormones and activate different carcinogens. Human CYP2A6, mouse CYP2A5 and rat CYP2A3 are orthologous enzymes that present high similarity in their amino acid sequence and share substrate specificities. However, different from the human and mouse enzyme, CYP2A3 is not expressed in the rat liver. There are limited data about expression of CYP2A3 in extrahepatic tissues and its regulation by typical CYP inducers. Therefore, the objective of the present study was to analyze CYP2A3 mRNA expression in different rat tissues by RT-PCR, and to study the influence of 3-methylcholanthrene, pyrazole and ß-ionone treatment on its expression. Male Wistar rats were divided into four groups of 5 rats each, and were treated ip for 4 days with 3-methylcholanthrene (25 mg/kg body weight), pyrazole (150 mg/kg body weight), ß-ionone (1 g/kg body weight), or vehicle. Total RNA was extracted from tissues and CYP2A3 mRNA levels were analyzed by semiquantitative RT-PCR. CYP2A3 mRNA was constitutively expressed in the esophagus, lung and nasal epithelium, but not along the intestine, liver, or kidney. CYP2A3 mRNA levels were increased in the esophagus by treatment with 3-methylcholanthrene and pyrazole (17- and 7-fold, respectively), in lung by pyrazole and ß-ionone (3- and 4-fold, respectively, although not statistically significant), in the distal part of the intestine and kidney by 3-methylcholanthrene and pyrazole, and in the proximal part of the intestine by pyrazole. CYP2A3 mRNA was not induced in nasal epithelium, liver or in the middle part of the intestine. These data show that, in the rat, CYP2A3 is constitutively expressed in several extrahepatic tissues and its regulation occurs through a complex mechanism that is essentially tissue specific.

Measurement of epidermal thickness in a patient with psoriasis by computer-supported image analysis

The aim of the present study was to measure full epidermal thickness, stratum corneum thickness, rete length, dermal papilla widening and suprapapillary epidermal thickness in psoriasis patients using a light microscope and computer-supported image analysis. The data obtained were analyzed in terms of patient age, type of psoriasis, total body surface area involvement, scalp and nail involvement, duration of psoriasis, and family history of the disease. The study was conducted on 64 patients and 57 controls whose skin biopsies were examined by light microscopy. The acquired microscopic images were transferred to a computer and measurements were made using image analysis. The skin biopsies, taken from different body areas, were examined for different parameters such as epidermal, corneal and suprapapillary epidermal thickness. The most prominent increase in thickness was detected in the palmar region. Corneal thickness was more pronounced in patients with scalp involvement than in patients without scalp involvement (t = -2.651, P = 0.008). The most prominent increase in rete length was observed in the knees (median: 491 µm, t = 10.117, P = 0.000). The difference in rete length between patients with a positive and a negative family history was significant (t = -3.334, P = 0.03), being 27% greater in psoriasis patients without a family history. The differences in dermal papilla distances among patients were very small. We conclude that microscope-supported thickness measurements provide objective results.

Effects of stress on catecholamine stores in central and peripheral tissues of long-term socially isolated rats

Both the peripheral sympatho-adrenomedullary and central catecholaminergic systems are activated by various psycho-social and physical stressors. Catecholamine stores in the hypothalamus, hippocampus, adrenal glands, and heart auricles of long-term socially isolated (21 days) and control 3-month-old male Wistar rats, as well as their response to immobilization of all 4 limbs and head fixed for 2 h and cold stress (4ºC, 2 h), were studied. A simultaneous single isotope radioenzymatic assay based on the conversion of catecholamines to the corresponding O-methylated derivatives by catechol-O-methyl-transferase in the presence of S-adenosyl-l-(³H-methyl)-methionine was used. The O-methylated derivatives were oxidized to ³H-vanilline and the radioactivity measured. Social isolation produced depletion of hypothalamic norepinephrine (about 18%) and hippocampal dopamine (about 20%) stores and no changes in peripheral tissues. Immobilization decreased catecholamine stores (approximately 39%) in central and peripheral tissues of control animals. However, in socially isolated rats, these reductions were observed only in the hippocampus and peripheral tissues. Cold did not affect hypothalamic catecholamine stores but reduced hippocampal dopamine (about 20%) as well as norepinephrine stores in peripheral tissues both in control and socially isolated rats, while epinephrine levels were unchanged. Thus, immobilization was more efficient in reducing catecholamine stores in control and chronically isolated rats compared to cold stress. The differences in rearing conditions appear to influence the response of adult animals to additional stress. In addition, the influence of previous exposure to a stressor on catecholaminergic activity in the brainstem depends on both the particular catecholaminergic area studied and the properties of additional acute stress. Therefore, the sensitivity of the catecholaminergic system to habituation appears to be tissue-specific.

Epidermal growth factor receptor (EGFR) mutations in lung cancer: preclinical and clinical data

Lung cancer leads cancer-related mortality worldwide. Non-small-cell lung cancer (NSCLC), the most prevalent subtype of this recalcitrant cancer, is usually diagnosed at advanced stages, and available systemic therapies are mostly palliative. The probing of the NSCLC kinome has identified numerous nonoverlapping driver genomic events, including epidermal growth factor receptor (EGFR) gene mutations. This review provides a synopsis of preclinical and clinical data on EGFR mutated NSCLC and EGFR tyrosine kinase inhibitors (TKIs). Classic somatic EGFR kinase domain mutations (such as L858R and exon 19 deletions) make tumors addicted to their signaling cascades and generate a therapeutic window for the use of ATP-mimetic EGFR TKIs. The latter inhibit these kinases and their downstream effectors, and induce apoptosis in preclinical models. The aforementioned EGFR mutations are stout predictors of response and augmentation of progression-free survival when gefitinib, erlotinib, and afatinib are used for patients with advanced NSCLC. The benefits associated with these EGFR TKIs are limited by the mechanisms of tumor resistance, such as the gatekeeper EGFR-T790M mutation, and bypass activation of signaling cascades. Ongoing preclinical efforts for treating resistance have started to translate into patient care (including clinical trials of the covalent EGFR-T790M TKIs AZD9291 and CO-1686) and hold promise to further boost the median survival of patients with EGFR mutated NSCLC.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Heavy metals investigation in bovine tissues in Brazil

The aim of this study was to investigate the presence of arsenic, lead, and cadmium residues in samples of liver, kidney, and muscle of cattle during the years of 2002 to 2008. A total of 1017 samples from 20 Brazilian States were used. The samples were analyzed at the National Agricultural Laboratory using the atomic absorption spectrometry technique. Arsenic residues were detected in 15.7% of liver samples and 28.7% of kidney samples although no results have exceeded the MRL. With regard to lead, 16 samples of liver and 74 samples of kidney were contaminated (5.2 and 10.9%, respectively). Among these samples, only one liver and two of kidney samples had lead levels above the MRL. Cadmium was found with levels below the MRL in 12.5% of the liver samples, and only 3 samples (1%) were quantified above the MRL. Among the kidney samples, 420 (60.8% of the total tested) had cadmium residues, and five of them exceeded the limits established by legislation. It is concluded that the Brazilian meat meets the legislation requirements without putting consumer's healthy at risk since as it satisfies the national and international food-safety conditions.

Presence of central nervous system tissues as bovine spongiform encephalopathy specified risk material in Turkish raw meat ball (cig kofte)

Abstract Bovine Spongiform Encephalopathy (BSE) is a virulent disease which may infect by affecting the central nervous system (CNS) tissues in cattle and causes degeneration in nerves. Central nervous system tissues such as brain and spinal cord which are classified as specified risk materials (SRMs) are regarded to be main source of infection. The contamination of the meat with the specific risk materials (SRMs) can occur in phases of slaughter, fragmentation of carcass and processing. This study was conducted in order to investigate the existence of CNS tissues in raw meat ball (cig kofte) which is commonly consumed in the Southeastern Region of Turkey, particularly in Şanlıurfa. For this purpose, 145 samples of raw meat ball were tested. The enzyme-linked immunosorbent assay (ELISA) kits (Ridascreen risk material 10/5, R-biofarm GmbH) which determine glial fibrillary acidic protein (GFAP) as determinant were used. As a result of the analyses, positivity was detected in 21 of totally 145 samples of raw meat ball (14.48%). 6 (4.14%) of the samples gave low level of positivity (≥ 0.1 standard absorbance), 10 (6.90%) gave medium level of positivity (>0.2 standard absorbance) and 5 (3.45%) gave high level of positivity (≥0.5 standard absorbance). As a consequence, meats are contaminated in any phase of both slaughter and meat production even if accidentally. Regarding this matter, necessary measures should be taken and hygiene rules should be applied.