Genomic characterization of Brazilian hepatitis C virus genotypes 1a and 1b

Parts of 5' non-coding (5' NC) and of E1 envelope regions of the hepatitis C virus (HCV) genome were amplified from sera of 26 Brazilian anti-HCV antibody-positive patients using the reverse transcription-polymerase chain reaction (RT-PCR). Fourteen samples were PCR positive with primers from the 5' NC region and 8 of them were also positive with primers from the E1 region. A genomic segment of 176 bp from the E1 region of 7 isolates was directly sequenced from PCR products. The sequences were compared with those of HCV strains isolated in other countries and the Brazilian isolates were classified by phylogenetic analysis into genotypes 1a and 1b. This could have a clinical importance since it has been shown that individuals infected with type 1 viruses are less likely to respond to treatment with interferon than individuals infected with types 2 and 3 viruses. Two quasispecies isolated from the same patient with an interval of 13 months differed by two base substitutions (1.1%). The sequence of another isolate presented a three-nucleotide deletion at codon 329

Chemokines, lymphocytes, and HIV

Chemokines are members of a family of more than 30 human cytokines whose best-described activities are as chemotactic factors for leukocytes and that are presumed to be important in leukocyte recruitment and trafficking. While many chemokines can act on lymphocytes, the roles of chemokines and their receptors in lymphocyte biology are poorly understood. The recent discoveries that chemokines can suppress infection by HIV-1 and that chemokine receptors serve, along with CD4, as obligate co-receptors for HIV-1 entry have lent urgency to studies on the relationships between chemokines and lymphocytes. My laboratory has characterized Mig and Crg-2/IP-10, chemokines that are induced by IFN-g and that specifically target lymphocytes, particularly activated T cells. We have demonstrated that the genes for these chemokines are widely expressed during experimental infections in mice with protozoan and viral pathogens, but that the patterns of mig and crg-2 expression differed, suggesting non-redundant roles in vivo. Our related studies to identify new chemokine receptors from activated lymphocytes resulted in the cloning of STRL22 and STRL33. We and others have shown that STRL22 is a receptor for the CC chemokine MIP-3a, and STRL22 has been re-named CCR6. Although STRL33 remains an orphan receptor, we have shown that it can function as a co-receptor for HIV-1 envelope glycoproteins, and that it is active with a broader range of HIV-1 envelope glycoproteins than the major co-receptors described to date. The ability of STRL33 to function with a wide variety of envelope glycoproteins may become particularly important if therapies are instituted to block other specific co-receptors. We presume that investigations into the roles of chemokines and their receptors in lymphocyte biology will provide information important for understanding the pathogenesis of AIDS and for manipulating immune and inflammatory responses for clinical benefit

Patch-clamp detection of macromolecular translocation along nuclear pores

The present paper reviews the application of patch-clamp principles to the detection and measurement of macromolecular translocation along the nuclear pores. We demonstrate that the tight-seal 'gigaseal' between the pipette tip and the nuclear membrane is possible in the presence of fully operational nuclear pores. We show that the ability to form a gigaseal in nucleus-attached configurations does not mean that only the activity of channels from the outer membrane of the nuclear envelope can be detected. Instead, we show that, in the presence of fully operational nuclear pores, it is likely that the large-conductance ion channel activity recorded derives from the nuclear pores. We conclude the technical section with the suggestion that the best way to demonstrate that the nuclear pores are responsible for ion channel activity is by showing with fluorescence microscopy the nuclear translocation of ions and small molecules and the exclusion of the same from the cisterna enclosed by the two membranes of the envelope. Since transcription factors and mRNAs, two major groups of nuclear macromolecules, use nuclear pores to enter and exit the nucleus and play essential roles in the control of gene activity and expression, this review should be useful to cell and molecular biologists interested in understanding how patch-clamp can be used to quantitate the translocation of such macromolecules into and out of the nucleus

Studies on the intrinsic nervous system of the wild rodent Calomys callosus digestive tract. II: The submucous plexus

The submucous plexus of the normal small and large intestine of Calomys callosus was studied by NADH and AChE histochemical techniques and by transmission and scanning electron microscopy. The plexus contains (mean ± SD) 7,488 ± 293 neurons/cm2 in the duodenum, 5,611 ± 836 in the jejunum, 2,741 ± 360 in the ileum, 3,067 ± 179 in the cecum, and 3,817 ± 256 in the proximal colon. No ganglia or nerve cell bodies were seen in the esophagus, stomach, distal colon or rectum. The neurons are pear-shaped with a round or oval nucleus and the neuronal cell profile areas were larger in the large intestine than in the small intestine. Most of the neurons display intense AChE activity in the cytoplasm. AChE-positive nerve fibers are present in a primary meshwork of large nerve bundles and in a secondary meshwork of finer nerve bundles. At the ultrastructural level, the ganglia are irregular in shape and covered with fibroblast-like cells. The nucleoplasm of the neurons is finely granular with a few condensations of chromatin attached to the nuclear envelope. In the neuropil numerous varicosities filled with vesicles of different size and electron densities are seen. The pre- and post-synaptic membrane thickenings are asymmetric. Characteristic glial cells with oval nuclei and few organelles are numerous. These data provide a detailed description of this submucosal meshwork.

Antigenic characterization of Brazilian bovine viral diarrhea virus isolates by monoclonal antibodies and cross-neutralization

Nineteen Brazilian isolates of bovine viral diarrhea virus (BVDV) were characterized antigenically with a panel of 19 monoclonal antibodies (mAbs) (Corapi WV, Donis RO and Dubovi EJ (1990) American Journal of Veterinary Research, 55: 1388-1394). Eight isolates were further characterized by cross-neutralization using sheep monospecific antisera. Analysis of mAb binding to viral antigens by indirect immunofluorescence revealed distinct patterns of reactivity among the native viruses. Local isolates differed from the prototype Singer strain in recognition by up to 14 mAbs. Only two mAbs - one to the non-structural protein NS23/p125 and another to the envelope glycoprotein E0/gp48 - recognized 100% of the isolates. No isolate was recognized by more than 14 mAbs and twelve viruses reacted with 10 or less mAbs. mAbs to the major envelope glycoprotein E2/gp53 revealed a particularly high degree of antigenic variability in this glycoprotein. Nine isolates (47.3%) reacted with three or less of 10 E2/gp53 mAbs, and one isolate was not recognized by any of these mAbs. Virus-specific antisera to eight isolates plus three standard BVDV strains raised in lambs had virus-neutralizing titers ranging from 400 to 3200 against the homologous virus. Nonetheless, many antisera showed significantly reduced neutralizing activity when tested against heterologous viruses. Up to 128-fold differences in cross-neutralization titers were observed for some pairs of viruses. When the coefficient of antigenic similarity (R) was calculated, 49 of 66 comparisons (74.24%) between viruses resulted in R values that antigenically distinguish strains. Moreover, one isolate had R values suggesting that it belongs to a distinct serologic group. The marked antigenic diversity observed among Brazilian BVDV isolates should be considered when planning diagnostic and immunization strategies.

HIV-1 subtypes among intravenous drug users from two neighboring cities in São Paulo State, Brazil

In order to assess the molecular epidemiology of HIV-1 in two neighboring cities located near the epicenter of the HIV-1 epidemics in Brazil (Santos and São Paulo), we investigated 83 HIV-1 strains obtained from samples collected in 1995 from intravenous drug users. The V3 through V5 region of the envelope of gp 120 was analyzed by heteroduplex mobility analysis. Of the 95 samples, 12 (12.6%) were PCR negative (6 samples from each group); low DNA concentration was the reason for non-amplification in half of these cases. Of the 42 typed cases from São Paulo, 34 (81%, 95% confidence limits 74.9 to 87.0%) were B and 8 (19%, 95% confidence limits 12.9 to 25.0%) were F, whereas of the 41 typed cases from Santos, 39 (95%, 95% confidence limits 91.6 to 98.4%) were B and 2 (5%, 95% confidence limits 1.6 to 8.4%) were C. We therefore confirm the relationship between clade F and intravenous drug use in São Paulo, and the presence of clade C in Santos. The fact that different genetic subtypes of HIV-1 are co-circulating indicates a need for continuous surveillance for these subtypes as well as for recombinant viruses in Brazil.

Viral membrane fusion: is glycoprotein G of rhabdoviruses a representative of a new class of viral fusion proteins?

Enveloped viruses always gain entry into the cytoplasm by fusion of their lipid envelope with a cell membrane. Some enveloped viruses fuse directly with the host cell plasma membrane after virus binding to the cell receptor. Other enveloped viruses enter the cells by the endocytic pathway, and fusion depends on the acidification of the endosomal compartment. In both cases, virus-induced membrane fusion is triggered by conformational changes in viral envelope glycoproteins. Two different classes of viral fusion proteins have been described on the basis of their molecular architecture. Several structural data permitted the elucidation of the mechanisms of membrane fusion mediated by class I and class II fusion proteins. In this article, we review a number of results obtained by our laboratory and by others that suggest that the mechanisms involved in rhabdovirus fusion are different from those used by the two well-studied classes of viral glycoproteins. We focus our discussion on the electrostatic nature of virus binding and interaction with membranes, especially through phosphatidylserine, and on the reversibility of the conformational changes of the rhabdovirus glycoprotein involved in fusion. Taken together, these data suggest the existence of a third class of fusion proteins and support the idea that new insights should emerge from studies of membrane fusion mediated by the G protein of rhabdoviruses. In particular, the elucidation of the three-dimensional structure of the G protein or even of the fusion peptide at different pH's might provide valuable information for understanding the fusion mechanism of this new class of fusion proteins.

Molecular epidemiology of type 1 and 2 dengue viruses in Brazil from 1988 to 2001

Dengue is a mosquito-borne viral infection that in recent decades has become a major international public health concern. Epidemic dengue fever reemerged in Brazil in 1981. Since 1990 more than one dengue virus serotype has been circulating in this tropical country and increasing rates of dengue hemorrhagic fever and dengue shock syndrome have been detected every year. Some evidence supports the association between the introduction of a new serotype and/or genotype in a region and the appearance of dengue hemorrhagic fever. In order to study the evolutionary relationships and possible detection of the introduction of new dengue virus genotypes in Brazil in the last years, we analyzed partial nucleotide sequences of 52 Brazilian samples of both dengue type 1 and dengue type 2 isolated from 1988 to 2001 from highly endemic regions. A 240-nucleotide-long sequence from the envelope/nonstructural protein 1 gene junction was used for phylogenetic analysis. After comparing the nucleotide sequences originally obtained in this study to those previously studied by others, and analyzing the phylogenetic trees, we conclude that, after the initial introduction of the currently circulating dengue-1 and dengue-2 genotypes in Brazil, there has been no evidence of introduction of new genotypes since 1988. The increasing number of dengue hemorrhagic fever cases seen in Brazil in the last years is probably associated with secondary infections or with the introduction of new serotypes but not with the introduction of new genotypes.

Attenuation and immunogenicity of recombinant yellow fever 17D-dengue type 2 virus for rhesus monkeys

A chimeric yellow fever (YF)-dengue serotype 2 (dengue 2) virus was constructed by replacing the premembrane and envelope genes of the YF 17D virus with those from dengue 2 virus strains of Southeast Asian genotype. The virus grew to high titers in Vero cells and, after passage 2, was used for immunogenicity and attenuation studies in rhesus monkeys. Subcutaneous immunization of naive rhesus monkeys with the 17D-D2 chimeric virus induced a neutralizing antibody response associated with the protection of 6 of 7 monkeys against viremia by wild-type dengue 2 virus. Neutralizing antibody titers to dengue 2 were significantly lower in YF-immune animals than in YF-naive monkeys and protection against challenge with wild-type dengue 2 virus was observed in only 2 of 11 YF-immune monkeys. An anamnestic response to dengue 2, indicated by a sharp increase of neutralizing antibody titers, was observed in the majority of the monkeys after challenge with wild-type virus. Virus attenuation was demonstrated using the standard monkey neurovirulence test. The 17D-D2 chimera caused significantly fewer histological lesions than the YF 17DD virus. The attenuated phenotype could also be inferred from the limited viremias compared to the YF 17DD vaccine. Overall, these results provide further support for the use of chimeric viruses for the development of a new live tetravalent dengue vaccine.

Diversity among satellite glial cells in dorsal root ganglia of the rat

Peripheral glial cells consist of satellite, enteric glial, and Schwann cells. In dorsal root ganglia, besides pseudo-unipolar neurons, myelinated and nonmyelinated fibers, macrophages, and fibroblasts, satellite cells also constitute the resident components. Information on satellite cells is not abundant; however, they appear to provide mechanical and metabolic support for neurons by forming an envelope surrounding their cell bodies. Although there is a heterogeneous population of neurons in the dorsal root ganglia, satellite cells have been described to be a homogeneous group of perineuronal cells. Our objective was to characterize the ultrastructure, immunohistochemistry, and histochemistry of the satellite cells of the dorsal root ganglia of 17 adult 3-4-month-old Wistar rats of both genders. Ultrastructurally, the nuclei of some satellite cells are heterochromatic, whereas others are euchromatic, which may result from different amounts of nuclear activity. We observed positive immunoreactivity for S-100 and vimentin in the cytoplasm of satellite cells. The intensity of S-100 protein varied according to the size of the enveloped neuron. We also noted that vimentin expression assumed a ring-like pattern and was preferentially located in the cytoplasm around the areas stained for S-100. In addition, we observed nitric oxide synthase-positive small-sized neurons and negative large-sized neurons equal to that described in the literature. Satellite cells were also positive for NADPH-diaphorase, particularly those associated with small-sized neurons. We conclude that all satellite cells are not identical as previously thought because they have different patterns of glial marker expression and these differences may be correlated with the size and function of the neuron they envelope.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.