64 resultados para Educational Function of Journalism


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Studies of cooking-generated NO2 effects are rare in occupational epidemiology. In the present study, we evaluated the lung function of professional cooks exposed to NO2 in hospital kitchens. We performed spirometry in 37 cooks working in four hospital kitchens and estimated the predicted FVC, FEV1 and FEF25-75, based on age, sex, race, weight, and height, according to Knudson standards. NO2 measurements were obtained for 4 consecutive days during 4 different periods at 20-day intervals in each kitchen. Measurements were performed inside and outside the kitchens, simultaneously using Palm diffusion tubes. A time/exposure indicator was defined as representative of the cumulative exposure of each cook. No statistically significant effect of NO2 exposure on FVC was found. Each year of work as a cook corresponded to a decrease in predicted FEV1 of 2.5% (P = 0.046) for the group as a whole. When smoking status and asthma were included in the analysis the effect of time/exposure decreased about 10% and lost statistical significance. On predicted FEF25-75, a decrease of 3.5% (P = 0.035) was observed for the same group and the inclusion of controllers for smoking status and asthma did not affect the effects of time/exposure on pulmonary function parameter. After a 10-year period of work as cooks the participants of the study may present decreases in both predicted FEV1 and FEF25-75 that can reach 20 and 30%, respectively. The present study showed small but statistically significant adverse effects of gas stove exposure on the lung function of professional cooks.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to evaluate the effect of metabolic syndrome (MetS) and its individual components on the renal function of patients with type 2 diabetes mellitus (DM). A cross-sectional study was performed in 842 type 2 DM patients. A clinical and laboratory evaluation, including estimated glomerular filtration rate (eGFR) calculated by the modification of diet in renal disease formula, was performed. MetS was defined according to National Cholesterol Education Program - Adult Treatment Panel III criteria. Mean patient age was 57.9 ± 10.1 years and 313 (37.2%) patients were males. MetS was detected in 662 (78.6%) patients. A progressive reduction in eGFR was observed as the number of individual MetS components increased (one: 98.2 ± 30.8; two: 92.9 ± 28.1; three: 84.0 ± 25.1; four: 83.8 ± 28.5, and five: 79.0 ± 23.0; P < 0.001). MetS increased the risk for low eGFR (<60 mL·min-1·1.73 (m²)-1) 2.82-fold (95%CI = 1.55-5.12, P < 0.001). Hypertension (OR = 2.2, 95%CI = 1.39-3.49, P = 0.001) and hypertriglyceridemia (OR = 1.62, 95%CI = 1.19-2.20, P = 0.002) were the individual components with the strongest associations with low eGFR. In conclusion, there is an association between MetS and the reduction of eGFR in patients with type 2 DM, with hypertension and hypertriglyceridemia being the most important contributors in this sample. Interventional studies should be conducted to determine if treatment of MetS can prevent renal failure in type 2 DM patients.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

To explore whether an environment of weightlessness will cause damage to the reproductive system of animals, we used the tail-suspension model to simulate microgravity, and investigated the effect of microgravity on the tissue structure and function of the testis in sexually mature male rats. Forty-eight male Wistar rats weighing 200-250 g were randomly assigned to three groups (N = 16 each): control, tail traction, and tail suspension. After the rats were suspended for 7 or 14 days, morphological changes of testis were evaluated by histological and electron microscopic methods. The expression of HSP70, bax/bcl-2 and AR (androgen receptor) in testis was measured by immunohistochemistry. Obvious pathological lesions were present in the testis after the rats were suspended for 7 or 14 days. We detected overexpression of HSP70 and an increase of apoptotic cells, which may have contributed to the injury to the testis. The expression of AR, as an effector molecule in the testis, was significantly decreased in the suspended groups compared to control (P < 0.01). We also observed that, with a longer time of suspension, the aforementioned pathological damage became more serious and some pathological injury to the testis was irreversible. The results demonstrated that a short- or medium-term microgravity environment could lead to severe irreversible damage to the structure of rat testis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The timing and mechanisms of protection by hyperbaric oxygenation (HBO) in hypoxic-ischemic brain damage (HIBD) have only been partially elucidated. We monitored the effect of HBO on the mitochondrial function of neuronal cells in the cerebral cortex of neonatal rats after HIBD. Neonatal Sprague-Dawley rats (total of 360 of both genders) were randomly divided into normal control, HIBD, and HIBD+HBO groups. The HBO treatment began immediately after hypoxia-ischemia (HI) and continued once a day for 7 consecutive days. Animals were euthanized 0, 2, 4, 6, and 12 h post-HI to monitor the changes in mitochondrial membrane potential (ΔΨm) occurring soon after a single dose of HBO treatment, as well as 2, 3, 4, 5, 6, and 7 days post-HI to study ΔΨm changes after a series of HBO treatments. Fluctuations in ΔΨm were observed in the ipsilateral cortex in both HIBD and HIBD+HBO groups. Within 2 to 12 h after HI insult, the ΔΨm of the HIBD and HIBD+HBO groups recovered to some extent. A secondary drop in ΔΨm was observed in both groups during the 1-4 days post-HI period, but was more severe in the HIBD+HBO group. There was a secondary recovery of ΔΨm observed in the HIBD+HBO group, but not in the HIBD group, during the 5-7 days period after HI insult. HBO therapy may not lead to improvement of neural cell mitochondrial function in the cerebral cortex in the early stage post-HI, but may improve it in the sub-acute stage post-HI.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Dulce de leche (DL), a dairy dessert highly appreciated in Brazil, is a concentrated product containing about 70% m/m of total solids. Thermophysical and rheological properties of two industrial Brazilian Dulce de leche formulations (classic Dulce de leche and Dulce de leche added with coconut flakes 1.5% m/m) were determined at temperatures comprised between 28.4 and 76.4 °C. In general, no significant differences (p < 0.05) were observed in the presence of coconut flakes in the two formulations. Heat capacity varied from 2633.2 to 3101.8 J/kg.°C; thermal conductivity from 0.383 to 0.452 W/m.°C; specific mass from 1350.7 to 1310.7 kg/m³; and, thermal diffusivity from (1.082 × 10-7 to 1.130 × 10-7) m²/s. The Bingham model was used to properly describe the non-Newtonian behavior of both formulations, with yielding stress values varying from 27.3 to 17.6 Pa and plastic viscosity from 19.9 to 5.9 Pa.s.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In Brazil, the largest producer of sugarcane in the world, the industrial process transforms this crop into ethanol and/or granulated sugar. Some cultivars exhibit enzymatic browning in the extracted sugarcane juice at levels harmful to the manufacturing process of white granulated sugar. The objective of this study was to assess the effect of sugarcane straw used as soil coverage, the use of different planting systems, and treatments with hydrogel polymer on enzymatic activity. The cultivar RB 86 7515 was sampled for 8 months; the first sample was obtained by cutting the upper portion of the stalk at the internode, which was taken to the laboratory for determination of the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The soil coverage with different forms of straw as well as the planting systems did not change the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The polyphenoloxidase (PPO) activity increased with the use of a polymer due to increased polyphenoloxidase (PPO) activity in the groove system. The enzymes studied showed changes in activity during the experimental period. The production of sugar at the end of the season (August to November) avoids the periods of highest enzymatic activity.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Jackfruit tree is one of the most significant trees in tropical home gardens and perhaps the most widespread and useful tree in the important genus Artocarpus. The fruit is susceptible to mechanical and biological damage in the mature state, and some people find the aroma of the fruit objectionable, particularly in confined spaces. The dehydration process could be an alternative for the exploitation of this product, and the relationship between moisture content and water activity provides useful information for its processing and storage. The aim of this study was to determine the thermodynamic properties of the water sorption of jackfruit (Artocarpus heterophyllus Lam.) as a function of moisture content. Desorption isotherms of the different parts of the jackfruit (pulp, peduncle, mesocarp, peel, and seed) were determined at four different temperatures (313.15, 323.15, 333.15, and 343.15 K) in a water activity range of 0.02-0.753 using the static gravimetric method. Theoretical and empirical models were used to model the desorption isotherms. An analytical solution of the Clausius-Clapeyron equation was proposed to calculate the isosteric heat of sorption, the differential entropy, and Gibbs' free energy using the Guggenhein-Anderson-de Boer and Oswin models considering the effect of temperature on the hygroscopic equilibrium.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Hot and dry weather conditions during soybean [Glycine max (L.) Merrill] seed maturation can cause forced maturation of the seed, resulting in the production of high levels of green seed, which may be detrimental to seed germination. These stressful conditions were imposed on soybean plants during seed maturation to investigate the production of green seeds and seed quality. Plants of the CD 206 cultivar were grown in a greenhouse until the R5.5 growing stage and then transferred to phytotrons at R6 and R7.2 for stress induction. Plants were subjected to two temperature regimes, high (28ºC to 36ºC) and normal (19ºC to 26ºC), and four soil water availability conditions, control (adequate water supply), 30% gravimetric moisture (GM), 20% GM and no water supply. Seed were harvested at R9. Green seed percentages and 100-seed weights from the lower, middle and upper thirds of each plant were determined. Seed quality was assessed by germination, tetrazolium (viability and vigor) and electrical conductivity tests. Occurrence of green seed varied from 9% to 86%, depending on the severity of the stresses imposed. High temperature, coupled with no water supply at R6, resulted in a pronounced occurrence of green seeds. There was no difference in the percentage of green seeds among the plant segments. Seed quality was negatively affected by the incidence of green seeds. A procedure for screening soybean genotypes in a phytotron for their tolerance and/or susceptibility to the production of green seeds was developed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Education for health is a process in which all public health and medical care personnel are involved. People learn both formally (planned learning experiences) and informally (unplanned learning experiences). Since the patient, the client, the consummer and the community expect public health and medical care personnel to assist them with health and disease issues and problems, the response of the professional "educates" the customer whether the professional intends to educate or not. Therefore, it is incumbent on all public health and medical care professionals to understand their educational functions and their role in health education. It is also important that the role of the specialist in education be clear. The specialist, as to all other specialists, has an in-depth knowledge of his area of expertise, i.e., the teaching/learning process; s/he may function as a consultant to others to enhance the educational potential of their role or s/he may work with a team or with communities or groups of patients. Specific competencies and knowledge are required of the health education specialist; and there is a body of learning and social change theory which provides a frame of reference for planning, implementing and evaluating educational programs. Working with others to enhance their potential to learn and to make informed decisions about health/disease issues is the hallmark of the health education specialist.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background: Coronary artery bypass graft (CABG) is a standard surgical option for patients with diffuse and significant arterial plaque. This procedure, however, is not free of postoperative complications, especially pulmonary and cognitive disorders. Objective: This study aimed at comparing the impact of two different physiotherapy treatment approaches on pulmonary and cognitive function of patients undergoing CABG. Methods: Neuropsychological and pulmonary function tests were applied, prior to and following CABG, to 39 patients randomized into two groups as follows: Group 1 (control) - 20 patients underwent one physiotherapy session daily; and Group 2 (intensive physiotherapy) - 19 patients underwent three physiotherapy sessions daily during the recovery phase at the hospital. Non-paired and paired Student t tests were used to compare continuous variables. Variables without normal distribution were compared between groups by using Mann-Whitney test, and, within the same group at different times, by using Wilcoxon test. The chi-square test assessed differences of categorical variables. Statistical tests with a p value ≤ 0.05 were considered significant. Results: Changes in pulmonary function were not significantly different between the groups. However, while Group 2 patients showed no decline in their neurocognitive function, Group 1 patients showed a decline in their cognitive functions (P ≤ 0.01). Conclusion: Those results highlight the importance of physiotherapy after CABG and support the implementation of multiple sessions per day, providing patients with better psychosocial conditions and less morbidity.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background:In chronic Chagas disease (ChD), impairment of cardiac autonomic function bears prognostic implications. Phase‑rectification of RR-interval series isolates the sympathetic, acceleration phase (AC) and parasympathetic, deceleration phase (DC) influences on cardiac autonomic modulation.Objective:This study investigated heart rate variability (HRV) as a function of RR-interval to assess autonomic function in healthy and ChD subjects.Methods:Control (n = 20) and ChD (n = 20) groups were studied. All underwent 60-min head-up tilt table test under ECG recording. Histogram of RR-interval series was calculated, with 100 ms class, ranging from 600–1100 ms. In each class, mean RR-intervals (MNN) and root-mean-squared difference (RMSNN) of consecutive normal RR-intervals that suited a particular class were calculated. Average of all RMSNN values in each class was analyzed as function of MNN, in the whole series (RMSNNT), and in AC (RMSNNAC) and DC (RMSNNDC) phases. Slopes of linear regression lines were compared between groups using Student t-test. Correlation coefficients were tested before comparisons. RMSNN was log-transformed. (α < 0.05).Results:Correlation coefficient was significant in all regressions (p < 0.05). In the control group, RMSNNT, RMSNNAC, and RMSNNDCsignificantly increased linearly with MNN (p < 0.05). In ChD, only RMSNNAC showed significant increase as a function of MNN, whereas RMSNNT and RMSNNDC did not.Conclusion:HRV increases in proportion with the RR-interval in healthy subjects. This behavior is lost in ChD, particularly in the DC phase, indicating cardiac vagal incompetence.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The dual function of eosinophils has been evidenced in protective immunity against parasites as well as in pathological manifestations during allergic disorders. We have demonstrated that a new class of IgE receptors, FcepsilonRII/CD23, was involved in the functional duality of eosinophils and other proinflammatory cells. More recently, we have shown that FcepsilonRI, the high affinity IgE receptor thought to be only expressed by basophils and mast cells, was involved in eosinophil-mediated cytotoxicity against schistosomes as well as in mediator release. These results favour the view that both IgE and its receptors have been primarily associated to a protective immune response, rather than to pathology. Not only IgE receptors but also members belonging to the family of adhesion molecules can participate as co-receptors in eosinophil effector function. The inhibitory role of monoclonal antibodies to LewisX (LeX, CD15) or to selectins in eosinophil-mediated cytotoxicity towards schistosomes and the detection of LeX and 'selectin-like' molecules on schistosomula surface indicate a double interaction mediated by selectins and their carbohydrate ligands between eosinophils and schistosomula. These results suggest new functions for these adhesion molecules, previously known to be involved mainly in cell infiltration.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Autotransplantation of spleen tissue has been done, in the past ten years, in children with schistosomiasis mansoni with bleeding varices. The purposes of this investigation were: (1) to study the morphology and function of the remnant spleen tissue; (2) to quantify the production of tuftsin; and (3) to assess the immune response to pneomococcal vaccine of these patients. Twenty three children, who underwent splenectomy and autologous implantation of spleen tissue into the greater omentum were included in this investigation. The average postoperative follow-up is five years. Splenosis was proved by colloid liver-spleen scans. Search for Howell-Jolly bodies assessed the filtration function. Tuftsin and the titer of pneumococcal antibodies were quantified by ELISA. Splenosis was evident in all children; however, it was insufficient in two. Howell-Jolly bodies were found only in these two patients. The mean tuftsin serum concentration (335.0 ± 29.8 ng/ml) was inside the normal range. The immune response to pneumococcal vaccination was adequate in 15 patients; intermediate in four; and inadequate in four. From the results the following conclusions can be drawn: splenosis was efficient in maintaining the filtration splenic function in more than 90% and produced tuftsin inside the range of normality. It also provided the immunologic splenic response to pneumococcal vaccination in 65% of the patients of this series.