55 resultados para DNA SEQUENCE


Relevância:

30.00% 30.00%

Publicador:

Resumo:

During its life cycle Leishmania spp. face several stress conditions that can cause DNA damages. Base Excision Repair plays an important role in DNA maintenance and it is one of the most conserved mechanisms in all living organisms. DNA repair in trypanosomatids has been reported only for Old World Leishmania species. Here the AP endonuclease from Leishmania (L.) amazonensis was cloned, expressed in Escherichia coli mutants defective on the DNA repair machinery, that were submitted to different stress conditions, showing ability to survive in comparison to the triple null mutant parental strain BW535. Phylogenetic and multiple sequence analyses also confirmed that LAMAP belongs to the AP endonuclease class of proteins.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Apple stem grooving virus (ASGV) is one of the most important viruses infecting fruit trees. This study aimed at the molecular characterization of ASGV infecting apple (Malus domestica) plants in Santa Catarina (SC). RNA extracted from plants infected with isolate UV01 was used as a template for RT-PCR using specific primers. An amplified DNA fragment of 755 bp was sequenced. The coat protein gene of ASGV isolate UV01 contains 714 nucleotides, coding for a protein of 237 amino acids with a predicted Mr of approximately 27 kDa. The nucleotide and the deduced amino acid sequences of the coat protein gene showed identities of 90.9% and 97.9%, respectively, with a Japanese isolate of ASGV. Very high amino acid homologies (98.7%) were also found with Citrus tatter leaf capillovirus (CTLV), a very close relative of ASGV. These results indicate low coat protein gene variability among Capillovirus isolates from distinct regions. In a restricted survey, mother stocks in orchards and plants introduced into the country for large scale fruit production were indexed and shown to be infected by ASGV (20%), usually in a complex with other (latent) apple viruses (80%).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Reverse transcriptase (RT) sequence analysis is an important technique used to detect the presence of transposable elements in a genome. Putative RT sequences were analyzed in the genome of the pathogenic fungus C. perniciosa, the causal agent of witches' broom disease of cocoa. A 394 bp fragment was amplified from genomic DNA of different isolates of C. perniciosa belonging to C-, L-, and S-biotypes and collected from various geographical areas. The cleavage of PCR products with restriction enzymes and the sequencing of various RT fragments indicated the presence of several sequences showing transition events (G:C to A:T). Southern blot analysis revealed high copy numbers of RT signals, forming different patterns among C-, S-, and L-biotype isolates. Sequence comparisons of the predicted RT peptide indicate a close relationship with the RT protein from thegypsy family of LTR-retrotransposons. The possible role of these retrotransposons in generating genetic variability in the homothallic C. perniciosa is discussed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Canine oral papillomavirus (COPV), also known as Canine Papillomavirus type 1 (CPV1), induces papillomas at the mucous membranes of the oral cavity and at the haired skin of dogs. The classification of Papillomavirus (PV) types is based on the L1 capsid protein and nucleotide sequence; so far, 14 CPV types have been described in several countries, but the molecular characterization of CPV in Brazil is lacking. This study investigated the presence of the PV in seven papillomas from four mixed breed dogs from Londrina/PR, Southern Brazil, by partial sequencing of the L1 gene. Seven exophytic cutaneous lesions were surgically removed and processed for histopathological and molecular characterization. Histopathology confirmed the lesions as viral papillomas due to typical histological features. Polymerase Chain Reaction (PCR) assay using the FAP59 and FAP64 primers targeted the L1 gene followed by sequence analysis of the amplicons identified CPV1 in all evaluated papilloma samples. This study represents the first description of CPV1 DNA associated with canine papillomatosis in Brazil.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

For certain applications of the polymerase chain reaction (PCR), it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq) DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We used the forward mutation assay to compare the fidelity of Taq polymerase and Thermotoga maritima (ULTMA™) DNA polymerase, an enzyme that does have proofreading activity. We did not find significant differences in the fidelity of either enzyme, even when using optimal buffer conditions, thermal cycling parameters, and number of cycles (0.2% and 0.13% error rates for ULTMA™ and Taq, respectively, after reading about 3,000 bases each). We conclude that for sequencing purposes there is no difference in using a DNA polymerase that contains an inherent 3' to 5' exonuclease activity for DNA amplification. Perhaps the specificity and fidelity of PCR are complex issues influenced by the nature of the target sequence, as well as by each PCR component.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

DNA-based immunization has initiated a new era of vaccine research. One of the main goals of gene vaccine development is the control of the levels of expression in vivo for efficient immunization. Modifying the vector to modulate expression or immunogenicity is of critical importance for the improvement of DNA vaccines. The most frequently used vectors for genetic immunization are plasmids. In this article, we review some of the main elements relevant to their design such as strong promoter/enhancer region, introns, genes encoding antigens of interest from the pathogen (how to choose and modify them), polyadenylation termination sequence, origin of replication for plasmid production in Escherichia coli, antibiotic resistance gene as selectable marker, convenient cloning sites, and the presence of immunostimulatory sequences (ISS) that can be added to the plasmid to enhance adjuvanticity and to activate the immune system. In this review, the specific modifications that can increase overall expression as well as the potential of DNA-based vaccination are also discussed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Restriction fragment length polymorphism (RFLP) was used to examine the extent of mtDNA polymorphism among six strains of rats (Rattus norvegicus) - Wistar, Wistar Munich, Brown Norway, Wistar Kyoto, SHR and SHR-SP. A survey of 26 restriction enzymes has revealed a low level of genetic divergence among strains. The sites of cleavage by EcoRI, NcoI and XmnI were shown to be polymorphic. The use of these three enzymes allows the 6 strains to be classified into 4 haplotypes and identifies specific markers for each one. The percentage of sequence divergence among all pairs of haplotypes ranged from 0.035 to 0.33%, which is the result of a severe population constriction undergone by the strains. These haplotypes are easily demonstrable and therefore RFLP analysis can be employed for genetic monitoring of rats within animal facilities or among different laboratories.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The features of the nucleotide sequences in both replication and promoter regions have been investigated in many organisms. Intrinsically bent DNA sites associated with transcription have been described in several prokaryotic organisms. The aim of the present study was to investigate intrinsic bent DNA sites in the segment that holds the chromosomal replication origin, oriC, of Xylella fastidiosa 9a5c. Electrophoretic behavior analyses, as well as in silico analyses of both the 2-D projection and helical parameters, were performed. The chromosomal segment analyzed contains the initial sequence of the rpmH gene, an intergenic region, the dnaA gene, the oriC sequence, and the 5' partial sequence of the dnaN gene. The analysis revealed fragments with reduced electrophoretic mobility, which indicates the presence of curved DNA segments. The analysis of the helical parameter ENDS ratio revealed three bent DNA sites (b1, b2, and b3) located in the rpmH-dnaA intergenic region, the dnaA gene, and the oriC 5' end, respectively. The chromosomal segment of X. fastidiosa analyzed here is rich in phased AT tracts and in CAnT motifs. The 2-D projection indicated a segment whose structure was determined by the cumulative effect of all bent DNA sites. Further, the in silico analysis of the three different bacterial oriC sequences indicated similar negative roll and twist >34.00° values. The DnaA box sequences, and other motifs in them, may be associated with the intrinsic DNA curvature.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Sequence-Characterized Amplified Region (SCAR) appears as a useful technique for genetic purity testing and variety discrimination, applicable to species in which some other techniques have failed. In particular, this technique is very attractive with species in which RAPD results were not consistent. The RAPD polymorphic bands were cloned, sequenced and from the sequence information, primers pairs for normal PCR were developed. Since the probability of obtaining successful SCAR primers from RAPD polymorphic bands was about 50%, a larger number of RAPD polymorphic bands are needed to develop sufficient SCAR primers for varietal discrimination in vinca. In addition, the efficiency of the SCAR technique is strongly affected by the quality of DNA extracted from seeds. The SCAR banding patterns obtained from vinca seed were consistent and repeatable making the results reliable for genetic purity testing and variety discrimination. The SCAR technique is simple, fast, relatively inexpensive and allows the use of DNA extracted from dry seeds, which is very important in a seed-quality evaluating program