Cellular and molecular studies of the effects of a selective COX-2 inhibitor celecoxib in the cardiac cell line H9c2 and their correlation with death mechanisms

Cardiovascular disease is one of the leading causes of death worldwide, and evidence indicates a correlation between the inflammatory process and cardiac dysfunction. Selective inhibitors of cyclooxygenase-2 (COX-2) enzyme are not recommended for long-term use because of potentially severe side effects to the heart. Considering this and the frequent prescribing of commercial celecoxib, the present study analyzed cellular and molecular effects of 1 and 10 µM celecoxib in a cell culture model. After a 24-h incubation, celecoxib reduced cell viability in a dose-dependent manner as also demonstrated in MTT assays. Furthermore, reverse transcription-polymerase chain reaction analysis showed that the drug modulated the expression level of genes related to death pathways, and Western blot analyses demonstrated a modulatory effect of the drug on COX-2 protein levels in cardiac cells. In addition, the results demonstrated a downregulation of prostaglandin E2 production by the cardiac cells incubated with celecoxib, in a dose-specific manner. These results are consistent with the decrease in cell viability and the presence of necrotic processes shown by Fourier transform infrared analysis, suggesting a direct correlation of prostanoids in cellular homeostasis and survival.

Immobilization and therapeutic passive stretching generate thickening and increase the expression of laminin and dystrophin in skeletal muscle

Extracellular matrix and costamere proteins transmit the concentric, isometric, and eccentric forces produced by active muscle contraction. The expression of these proteins after application of passive tension stimuli to muscle remains unknown. This study investigated the expression of laminin and dystrophin in the soleus muscle of rats immobilized with the right ankle in plantar flexion for 10 days and subsequent remobilization, either by isolated free movement in a cage or associated with passive stretching for up to 10 days. The intensity of the macrophage response was also evaluated. One hundred and twenty-eight female Wistar rats were divided into 8 groups: free for 10 days; immobilized for 10 days; immobilized/free for 1, 3, or 10 days; or immobilized/stretched/free for 1, 3, or 10 days. After the experimental procedures, muscle tissue was processed for immunofluorescence (dystrophin/laminin/CD68) and Western blot analysis (dystrophin/laminin). Immobilization increased the expression of dystrophin and laminin but did not alter the number of macrophages in the muscle. In the stretched muscle groups, there was an increase in dystrophin and the number of macrophages after 3 days compared with the other groups; dystrophin showed a discontinuous labeling pattern, and laminin was found in the intracellular space. The amount of laminin was increased in the muscles treated by immobilization followed by free movement for 10 days. In the initial stages of postimmobilization (1 and 3 days), an exacerbated macrophage response and an increase of dystrophin suggested that the therapeutic stretching technique induced additional stress in the muscle fibers and costameres.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Plasma levels and placental expression of vaspin in pregnant women with diabetes mellitus

The present study aimed to investigate visceral adipose tissue-specific serpin (vaspin) concentrations in serum and term placentas and relate these values to insulin resistance and lipid parameters in women with gestational diabetes mellitus (GDM). A total of 30 GDM subjects and 27 age-matched pregnant women with normal glucose tolerance (NGT, control) were included. Serum glucose, glycated hemoglobin (HbA1c), lipid profile, insulin, and vaspin were measured at the end of pregnancy, and homeostasis model of assessment-insulin resistance (HOMA-IR) values were calculated. Vaspin mRNA and protein levels in placentas were measured by real-time fluorescence quantitative reverse transcription polymerase chain reaction (RT-qPCR) and Western blotting, respectively. Serum vaspin levels were significantly lower in the GDM group than in controls (0.49±0.24 vs 0.83±0.27 ng/mL, respectively; P<0.01). Three days after delivery, serum vaspin levels were significantly decreased in subjects with GDM (0.36±0.13 vs0.49±0.24 ng/mL, P<0.01). However, in the GDM group, serum vaspin levels were not correlated with the parameters evaluated. In contrast, in the control group, serum vaspin levels were positively correlated with triglycerides (TG; r=0.45, P=0.02) and very low-density lipoprotein cholesterol (VLDL-C; r=0.42, P=0.03). Placental mRNA vaspin (0.60±0.32 vs0.68±0.32, P=0.46) and protein (0.30±0.08 vs0.39±0.26; P=0.33) levels in the GDM group did not differ significantly from those in the control group, but were negatively correlated with neonatal birth weight in the GDM group (r=-0.48, P=0.03; r=-0.88; P<0.01). Our findings indicated that vaspin may be an important adipokine involved in carbohydrate and lipid metabolism and may also play a role in fetal development.

Effects of IL-10 and glucose on expression of OPG and RANKL in human periodontal ligament fibroblasts

The effects of interleukin-10 (IL-10) and glucose on mRNA and protein expression of osteoprotegerin (OPG), and its ligand, receptor activator of nuclear factor-κB ligand (RANKL), were investigated in human periodontal ligament fibroblasts (HPDLFs). Primary HPDLFs were treated with different concentrations of IL-10 (0, 1, 10, 25, 50, and 100 ng/mL) or glucose (0, 5.5, 10, 20, 30, and 40 mmol/L). Changes in mRNA and protein expression were examined using the reverse-transcription polymerase chain reaction (RT-PCR) and Western blot analysis, respectively. After IL-10 treatment, mRNA and protein levels of OPG were increased, while mRNA and protein levels of RANKL were decreased (P<0.05), both in a concentration-dependent manner. Glucose stimulation had the opposite concentration-dependent effect to that of IL-10 on OPG and RANKL expression. IL-10 upregulated OPG expression and downregulated RANKL expression, whereas high glucose upregulated RANKL and downregulated OPG in HDPLFs. Abnormal levels of IL-10 and glucose may contribute to the pathogenesis of periodontal disease.

'TINA', Aids, and the underdevelopment problem in Africa

The assumption that 'There Is No Alternative' (TINA) to capitalism as practiced in the United States of America and Western Europe has been the bane of aids effectiveness in assisting to solve the underdevelopment problem in Africa. This paper attempts to show that except there is a fundamental reorientation in the conceptualization of capitalism-free market and democracy-the underdevelopment problem would only be further complicated with aids.