104 resultados para Antepartum non-stress test
Resumo:
AbstractOBJECTIVETo evaluate the relationship between perceived stress and comorbidities, neurological deficit, functional independence and depressive symptoms of stroke survivors after hospital discharge.METHODCross-sectional study with 90 elderly stroke survivors. The National Institutes of Health Stroke Scale instrument, the Functional Independence Measure instrument, the Geriatric Depression Scale and the Perceived Stress Scale were used. Bivariate Pearson correlation, independent t test and multiple regression analysis were used to evaluate the relationship between perceived stress and other variables.RESULTSThe final regression model showed that higher perceived stress was related to less functional independence (p= 0.022) and more depressive symptoms (p <0.001).CONCLUSIONAt hospital discharge, interventions should be planned for the treatment of depressive symptoms and to create adaptation strategies to the reduction of functional independence, in order to reduce the stress of the survivors.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
The objective of this work was to determine the effects of seed priming and sulfur application on cell membrane characteristics, seedling emergence, chlorophyll content and grain yield of soybean (Glycine max) in saline soil. A complete-block design in 4x3 factorial arrangement with three replicates was used to test four types of seed priming (water, auxin, gibberellin and non-priming) and three levels of sulfate availability (0, 70 and 140 kg ha-1 K2SO4). The soil had a silty loam texture with an electrical conductivity of 3.61 ds m-1, a pH of 8.2 and a saturation percentage of about 46%. Seed priming had significant effects on mean emergence rate (MER), emergence percentage, relative water content (RWC) of leaves, relative chlorophyll content, time of maturity, shoot length and grain yield. The highest values for these variables were observed in the priming treatments, except for the time of maturity. Sulfur application had significant effects on MER, shoot length, RWC, membrane injury index and grain yield. Priming treatments provide greater emergence rates and grain yields and interact sinergicaly with sulfur rates.
Resumo:
The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.
Resumo:
Cefdinir has broad spectrum of activity and high prescription rates, hence its counterfeiting seems imminent. We have proposed a simple, fast, selective and non-extractive spectrophotometric method for the content assay of cefdinir in formulations. The method is based on complexation of cefdinir and Fe under reducing condition in a buffered medium (pH 11) to form a magenta colored donor-acceptor complex (λ max = 550 nm; apparent molar absorptivity = 3720 L mol-1 cm-1). No other cephalosporins, penicillins and common excipients interfere under the test conditions. The Beer's law is followed in the concentration range 8-160 µg mL-1.
Resumo:
Four simple titrimetric procedures are described for the determination of lisinopril (LNP) in bulk and in pharmaceuticals based on the neutralization of basic-amino and acidic carboxylic acid groups present in LNP. Method A is based on the neutralization of basic amino groups using perchloric acid as titrant in anhydrous acetic acid medium. Method B, method C and method D are based on neutralization of carboxylic acid group using NaOH, sodium methoxide and methanolic KOH, as titrants, respectively. Method A is applicable over 2.0-20.0 mg range and the calculations are based in the molar ratio of 1:2 (LNP:HClO4). Method B, method C and method D are applicable over 2.0-20.0 mg, 1.0-10.0 mg and 5.0-15.0 mg range, respectively, and their respective molar ratios are 1:1 (LNP:NaOH), 1:2 (LNP:CH3ONa) and 1:1 (LNP:KOH). Intraday and inter day accuracy and precision of the methods were evaluated and the results showed intra- and inter-day precision less than 2.7% (RSD), and accuracy of < 2.5 % (RE). The developed methods were applied to determine LNP in tablets and the results were validated statistically by comparing the results with those of the reference method by applying the Student's t-test and F-test. The accuracy was further ascertained by recovery studies via standard addition technique. No interferences from common tablet exipients was observed.
Resumo:
Quantifying soil evaporation is required on studies of soil water balance and applications aiming to improve water use efficiency by crops. The performance of a microlysimeter (ML) to measure soil evaporation under irrigation and non-irrigation was evaluated. The MLs were constructed using PVC tubes, with dimensions of 100 mm inner diameter, 150 mm depth and 2.5 mm wall thickness. Four MLs were uniformly distributed on the soil surface of two weighing lysimeters conducted under bare soil, previously installed at Iapar, in Londrina, PR, Brazil. The lysimeters had 1.4 m width, 1.9 m length and 1.3 m depth and were conducted with and without irrigation. Evaporation measurements by MLs (E ML) were compared with measurements by lysimeters (E L) during four different periods in the year. Differences between E ML and E L were small either for low or high atmospheric demand and also for either irrigated or non-irrigated conditions, which indicates that the ML tested here is suitable for measurement of soil evaporation.
Resumo:
The experiment was conducted in an orchard located in University of Florida (Citrus Research and Education Center), Lake Alfred, Polk County, Florida, USA. The objective of this study was to evaluate the effects of water stress in root distribution of 'Valencia' orange tree on 'Swingle' citrumelo rootstock. Three treatments were imposed on the trees: 1) normal irrigation with microsprinklers, 2) no irrigation in winter (November through mid-March) and 3) rainfall exclusion by placing a water repelling fabric (Tyvek) under the trees. Trees in treatments 1 and 2 received normal rainfall during the winter, but treatment 3 received no rain. Normal irrigation was resumed on all treatments in mid March. Soil was collected using root auger head (0.09 m diameter and height 0.25 m) in two opposing quadrants (West and East at 3 horizontal distances from tree trunk (1, 2 and 3 m) and 4 depths (0.0-0.15; 0.15-0.30; 0.30-0.60 and 0.60-0.90 m). The results from root sampling showed that there was a significant difference in root distribution between irrigated treatment and non irrigated/non rainfall.
Resumo:
This study aims to evaluate the leaf concentration of nitrogen and phosphorus correlated to the production of photoassimilates in beans plants (Phaseolus vulgaris L.) under high [CO2] and drought stress. The experiment was conducted in Viçosa (Brazil), during the period from April to July 2009, by using open-top chambers equipped with CO2 injection system. The drought stress was applied, through the irrigation suspension, during the period from flowering to maturation. The experimental design was randomized blocks in split-plot scheme with four replication, where the plots with plants grown in [CO2] of 700 mg L-1 and [CO2] environment of 380 mg L-1 and the subplots with plants with and without drought stress. The results were submitted to ANOVA and Tukey test (p < 0.05). In the plants under high [CO2] with and without drought stress, the photosynthetic rate increased by 59%, while the dry matter presented an increment of 20% in the plants under high [CO2] without drought stress. Reductions in [N] and [P] occurred in plants grown under high [CO2], resulting in greater efficiency in nitrogen use for photosynthesis. The high [CO2] increase only the total dry matter and not the total mass of grains. The drought stress reduces the dry matter and mass of grain, even at high [CO2].
Resumo:
OBJECTIVE: to evaluate the impact of stress in patients undergoing major surgeries under general anesthesia, relating their physical and psychic reactions to the different stages of stress. METHODS: we studied 100 adult patients of both genders, who were divided into two groups: Group 1 - 22 patients without experience with surgery; Group 2 - 78 patients previously submitted to medium and major surgery. To investigate the stress, we used the Inventory of Stress Symptoms for Adults, developed by Lipp, the day before the procedure and two days and seven days after the operation. The comparison of groups with respect to gender, pain, and percentage of stress were performed using the Chi-square test, and for the age variable the Student's t test was used. Differences were considered significant at p<0.05. RESULTS: the groups were not homogeneous as for the overall percentage of stress on the three measurements. G1 had decreased postoperative stress, whilst in G2 it increased. Psychological symptoms of stress prevailed in both groups. CONCLUSION: previous surgery reduced preoperative stress but did not affect postoperative emotional disorders.
Resumo:
Objective: To assess the application of aponeurotic sling by a modified technique with direct visualization of needles in patients with stress urinary incontinence. Methods: we applied the Kings Health Questionnaire (KHQ) for quality of life, gynecological examination, urinalysis I and urine culture approximately seven days prior to the urodynamic study (UDS) and the one-hour PAD test in patients undergoing making aponeurotic sling with its passing through the retropubic route with direct visualization of the needle, PAD test and King's Helth Questionnaire before and after surgery. Results: The mean age was 50.6 years, BMI of 28 and Leak Pressure (LP) 58,5cm H2O; 89% were Caucasian. Forty-six of them were monitored for three and six months, 43 for 12 months. The objective cure rate at 12 months postoperatively was approximately 93.5%. In evaluating quality of life, we observed a significant improvement in 12 months postoperatively compared with the preoperative period. There was no no urethral/bladder injury. As adverse results, we had one persistent urinary retention (2.3%), who was submitted to urethrolysis, currently without incontinence. Conclusion: The proposed procedure is safe as for the risk of bladder or urethral injuries, promoting significant improvement in quality of life and objective cure.
Resumo:
PURPOSE: The aim of this study was to evaluate serum levels of inducible nitric oxide synthase (INOS), myeloperoxidase (MPO), total antioxidant status (TAS), and total oxidative status (TOS) in women with primary ovarian insufficiency (POI) and to compare them with healthy fertile women. We also examined the possible risk factors associated with POI.METHODS: This cross-sectional case control study was conducted in Zekai Tahir Burak Women's Health Education and Research Hospital. The study population consisted of 44 women with POI (study group) and 36 healthy fertile women (control group). In all patients, serum levels of INOS, MPO, TAS, and TOS were determined. INOS and MPO levels were measured by enzyme-linked immunosorbent assay whereas colorimetric method was used for evaluating TAS and TOS levels. Age, body mass index (BMI), obstetric history, smoking status, family history, comorbidities, sonographic findings, complete blood count values, C-reactive protein and baseline hormone levels were also analyzed. Student's t-test or Mann-Whitney U test was used to compare continuous variables between the groups; categorical data were evaluated by using Pearson χ2 or Fisher exact test, when appropriate. Binary logistic regression method was used to identify risk factors for POI.RESULTS: We found significantly elevated levels of INOS (234.1±749.5 versus133.8±143.0; p=0.005), MPO (3,438.7±1,228.6 versus 2,481.9±1,230.1; p=0.001), and TOS (4.3±1.4 versus 3.6±1.4; p=0.02) in the sera of the study group when compared to the BMI-age matched control group. However, difference in serum levels of TAS were not significant between the 2 groups (1.7±0.2 versus 1.6±0.2; p=0.15). Logistic regression method demonstrated that BMI <25 kg/m2, nulliparity, family history of POI, smoking, and elevated serum levels of INOS, MPO, and TOS were independent risk factors for POI.CONCLUSION: We found an increase in INOS, MPO, and TOS in women with POI. These serum markers may be promising in early diagnosis of POI. Further large-scale studies are required to determine whether oxidative stress markers have a role in diagnosing POI.
Resumo:
Abstract PURPOSE: To compare differences in the occurrence and changed domains of sexual dysfunction in obese and non-obese Brazilian women. METHODS: Female Sexual Function Index, based on six domains, to investigate 31 sexual dysfunction incidence for obese compared to 32 non-obese women, was used. Statistical analysis using ANOVA and MANOVA were performed to compare total scores of Female Sexual Function Index among groups and to identify the differences among domains, Student t -test was used. Statistical significant level was established for all tests for p<0.05. RESULTS: No difference in female sexual dysfunction frequency between obese (25.8%) and non-obese women (22.5%) was found. However, an important distinction in which aspects of sexual life were affected was found. While the obese group was impaired in three domains of sexual life (desire, orgasm, and arousal), in the control group five aspects were dysfunctional (desire, orgasm, arousal, pain and lubrication). Future research exploring psychological outcomes in obese females, such as body image and measures of positive and negative effect, might better characterize the female sexual dysfunction in this group. CONCLUSIONS: Obesity does not appear to be an independent factor for allow quality of female sexual life. However, disturbance associated to obesity indicates a low frequency of disorder in physical domains, suggesting that psychological factors seem to be mainly involved in the sexual dysfunction in obese women.
Resumo:
We performed a systematic review and meta-analysis of randomized controlled trials that studied the conservative management of stress urinary incontinence (SUI). There were 1058 results after the initial searches, from which 37 studies were eligible according to previously determined inclusion criteria. For the primary outcomes, pelvic floor muscle training (PFMT) was more efficacious than no treatment in improving incontinence-specific quality of life (QoL) scales (SMD = [1]1.24SDs; CI 95% = [1]1.77 to [1]0.71SDs). However, its effect on pad tests was imprecise. Combining biofeedback with PFMT had an uncertain effect on QoL (MD = [1]4.4 points; CI 95% = [1]16.69 to 7.89 points), but better results on the pad test, although with elevated heterogeneity (MD = 0.9g; 95%CI = 0.71 to 1,10g); group PFMT was not less efficacious than individual treatment, and home PFMT was not consistently worse than supervised PFMT. Both intravaginal and superficial electrical stimulation (IES and SES) were better than no treatment for QoL and pad test. Vaginal cones had mixed results. The association of IES with PFMT may improve the efficacy of the latter for QoL and pad test, but the results of individual studies were not consistent. Thus, there is evidence of the use of PFMT on the treatment of SUI, with and without biofeedback.
Resumo:
A rapid conglutination test (RCT) with performance comparable to the indirect fluorescent antibody technique (IFAT) was developed to detect antibodies against Babesia bigemina (B. bigemina-RCT). The B. bigemina-RCT is a sensitive, specific, economical, and rapidly performed serological test suitable for field application or minimally equipped laboratories. This test had a sensitivity of 90.9%, and specificity of 97.6%, compared to IFAT, which showed for the same parameters respectively, 98.3% and 99.7%. The early detection of anti- B. bigemina immunoglobulins by RCT in experimental infections was nearly parallel to that of IFAT. Cross reactions were observed with sera from calves experimentally infected with Babesia bovis (1.8%) and with Anaplasma marginale (1.2%). RCT antigen prepared with non parasitized erythrocytes (negative antigen) showed 1.5%, 3.5% and 2.2% of positive reactions with sera from animals experimentally infected with B. bigemina, B. bovis and A. marginale. However, none of the sera from animals of endemic areas for babesia infection resulted in positive reactions with the negative antigen. Considering these results and shelf life over six months, the B. bigemina-RCT could be used for epidemiological surveys and evaluation of control measures against this species of Babesia.