Inhibition of STAT3 by RNA interference suppresses angiogenesis in colorectal carcinoma

In order to investigate signal transduction and activation of transcription 3 (STAT3) signaling on angiogenesis in colorectal carcinoma (CRC) after inhibiting STAT3 expression, we constructed the HT-29-shSTAT3 cell line by lentivirus-mediated RNAi. Cell growth was assessed with MTT and the cell cycle distribution by flow cytometry. CRC nude mouse models were established and tumor growth was monitored periodically. On day 30, all mice were killed and tumor tissues were removed. Microvessel density (MVD) was determined according to CD34-positive staining. The expression of vascular endothelial growth factor A (VEGFA), matrix metalloproteinase-2 (MMP2) and basic fibroblast growth factor (FGF2) was monitored by quantitative real-time PCR and Western blot analysis. Knockdown of STAT3 expression significantly inhibited cell growth in HT-29 cells, with a significantly higher proportion of cells at G0/G1 (P < 0.01). Consistently, in vivo data also demonstrated that tumor growth was significantly inhibited in mice injected with HT-29-shSTAT3 cells. MVD was 9.80 ± 3.02 in the HT-29-shSTAT3 group, significantly less than that of the control group (P < 0.01). mRNA and protein levels of VEGFA and MMP2 in the HT-29-shSTAT3 group were significantly lower than in the control group (P < 0.05), but no significant difference was observed in the mRNA or protein level of FGF2 (P > 0.05). Taken together, these results demonstrate that STAT3 signaling is important to the growth of CRC and promotes angiogenesis by regulating VEGFA and MMP2 expression.

BC047440 antisense eukaryotic expression vectors inhibited HepG2 cell proliferation and suppressed xenograft tumorigenicity

The biological functions of the BC047440 gene highly expressed by hepatocellular carcinoma (HCC) are unknown. The objective of this study was to reconstruct antisense eukaryotic expression vectors of the gene for inhibiting HepG2 cell proliferation and suppressing their xenograft tumorigenicity. The full-length BC047440 cDNA was cloned from human primary HCC by RT-PCR. BC047440 gene fragments were ligated with pMD18-T simple vectors and subsequent pcDNA3.1(+) plasmids to construct the recombinant antisense eukaryotic vector pcDNA3.1(+)BC047440AS. The endogenous BC047440 mRNA abundance in target gene-transfected, vector-transfected and naive HepG2 cells was semiquantitatively analyzed by RT-PCR and cell proliferation was measured by the MTT assay. Cell cycle distribution and apoptosis were profiled by flow cytometry. The in vivo xenograft experiment was performed on nude mice to examine the effects of antisense vector on tumorigenicity. BC047440 cDNA fragments were reversely inserted into pcDNA3.1(+) plasmids. The antisense vector significantly reduced the endogenous BC047440 mRNA abundance by 41% in HepG2 cells and inhibited their proliferation in vitro (P < 0.01). More cells were arrested by the antisense vector at the G1 phase in an apoptosis-independent manner (P = 0.014). Additionally, transfection with pcDNA3.1(+)BC047440AS significantly reduced the xenograft tumorigenicity in nude mice. As a novel cell cycle regulator associated with HCC, the BC047440 gene was involved in cell proliferation in vitro and xenograft tumorigenicity in vivo through apoptosis-independent mechanisms.

Antigen-presenting cells transfected with Hsp65 messenger RNA fail to treat experimental tuberculosis

In the last several years, the use of dendritic cells has been studied as a therapeutic strategy against tumors. Dendritic cells can be pulsed with peptides or full-length protein, or they can be transfected with DNA or RNA. However, comparative studies suggest that transfecting dendritic cells with messenger RNA (mRNA) is superior to other antigen-loading techniques in generating immunocompetent dendritic cells. In the present study, we evaluated a new therapeutic strategy to fight tuberculosis using dendritic cells and macrophages transfected with Hsp65 mRNA. First, we demonstrated that antigen-presenting cells transfected with Hsp65 mRNA exhibit a higher level of expression of co-stimulatory molecules, suggesting that Hsp65 mRNA has immunostimulatory properties. We also demonstrated that spleen cells obtained from animals immunized with mock and Hsp65 mRNA-transfected dendritic cells were able to generate a mixed Th1/Th2 response with production not only of IFN-γ but also of IL-5 and IL-10. In contrast, cells recovered from mice immunized with Hsp65 mRNA-transfected macrophages were able to produce only IL-5. When mice were infected with Mycobacterium tuberculosis and treated with antigen-presenting cells transfected with Hsp65 mRNA (therapeutic immunization), we did not detect any decrease in the lung bacterial load or any preservation of the lung parenchyma, indicating the inability of transfected cells to confer curative effects against tuberculosis. In spite of the lack of therapeutic efficacy, this study reports for the first time the use of antigen-presenting cells transfected with mRNA in experimental tuberculosis.

Targeting PPM1D by lentivirus-mediated RNA interference inhibits the tumorigenicity of bladder cancer cells

Protein phosphatase magnesium/manganese-dependent 1D (PPM1D) is a p53-induced phosphatase that functions as a negative regulator of stress response pathways and has oncogenic properties. However, the functional role ofPPM1D in bladder cancer (BC) remains largely unknown. In the present study, lentivirus vectors carrying small hairpin RNA (shRNA) targeting PPM1D were used to explore the effects ofPPM1D knockdown on BC cell proliferation and tumorigenesis. shRNA-mediated knockdown of PPM1D significantly inhibited cell growth and colony forming ability in the BC cell lines 5637 and T24. Flow cytometric analysis showed that PPM1D silencing increased the proportion of cells in the G0/G1 phase. Downregulation of PPM1Dalso inhibited 5637 cell tumorigenicity in nude mice. The results of the present study suggest that PPM1D plays a potentially important role in BC tumorigenicity, and lentivirus-mediated delivery of shRNA againstPPM1D might be a promising therapeutic strategy for the treatment of BC.

Optimization of the RNeasy Mini Kit to obtain high-quality total RNA from sessile cells of Staphylococcus aureus

Biofilm formed by Staphylococcus aureus is considered an important virulence trait in the pathogenesis of infections associated with implantable medical devices. Gene expression analyses are important strategies for determining the mechanisms involved in production and regulation of biofilm. Obtaining intact RNA preparations is the first and most critical step for these studies. In this article, we describe an optimized protocol for obtaining total RNA from sessile cells of S. aureus using the RNeasy Mini Kit. This method essentially consists of a few steps, as follows: 1) addition of acetone-ethanol to sessile cells, 2) lysis with lysostaphin at 37°C/10 min, 3) vigorous mixing, 4) three cycles of freezing and thawing, and 5) purification of the lysate in the RNeasy column. This simple pre-kit procedure yields high-quality total RNA from planktonic and sessile cells of S. aureus.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.