93 resultados para tobacco BY-2 cells
Resumo:
Schwann cells produce and release trophic factors that induce the regeneration and survival of neurons following lesions in the peripheral nerves. In the present study we examined the in vitro ability of developing rat retinal cells to respond to factors released from fragments of sciatic nerve. Treatment of neonatal rat retinal cells with sciatic-conditioned medium (SCM) for 48 h induced an increase of 92.5 ± 8.8% (N = 7 for each group) in the amount of total protein. SCM increased cell adhesion, neuronal survival and glial cell proliferation as evaluated by morphological criteria. This effect was completely blocked by 2.5 µM chelerythrine chloride, an inhibitor of protein kinase C (PKC). These data indicate that PKC activation is involved in the effect of SCM on retinal cells and demonstrate that fragments of sciatic nerve release trophic factors having a remarkable effect on neonatal rat retinal cells in culture.
Resumo:
Human localized cutaneous leishmaniasis (LCL), induced by Leishmania braziliensis, ranges from a clinically mild, self-healing disease with localized cutaneous lesions to severe forms which can present secondary metastatic lesions. The T cell-mediated immune response is extremely important to define the outcome of the disease; however, the underlying mechanisms involved are not fully understood. A flow cytometric analysis of incorporation of 7-amino actinomycin D and CD4+ or CD8+ T cell surface phenotyping was used to determine whether different frequencies of early apoptosis or accidental cell death occur at different stages of LCL lesions. When all cells obtained from a biopsy sample were analyzed, larger numbers of early apoptotic and dead cells were observed in lesions from patients with active disease (mean = 39.5 ± 2.7%) as compared with lesions undergoing spontaneous healing (mean = 17.8 ± 2.2%). Cells displaying normal viability patterns obtained from active LCL lesions showed higher numbers of early apoptotic events among CD8+ than among CD4+ T cells (mean = 28.5 ± 3.8 and 15.3 ± 3.0%, respectively). The higher frequency of cell death events in CD8+ T cells from patients with LCL may be associated with an active form of the disease. In addition, low frequencies of early apoptotic events among the CD8+ T cells were observed in two patients with self-healing lesions. Although the number of patients in the latter group was small, it is possible to speculate that, during the immune response, differences in apoptotic events in CD4+ and CD8+ T cell subsets could be responsible for controlling the CD4/CD8 ratio, thus leading to healing or maintenance of disease.
Resumo:
In the present study we evaluated T cell proliferation and Th lymphokine patterns in response to gp43 from Paracoccidioides brasiliensis presented by isolated dendritic cells from susceptible and resistant mice. T cell proliferation assays showed that dendritic cells from susceptible mice were less efficient than those from resistant mice. The pattern of T cell lymphokines stimulated by dendritic cells was always Th1, although the levels of IL-2 and IFN-gamma were lower in T cell cultures from susceptible mice. To determie whether different antigen-presenting cells such as macrophages and dendritic cells stimulated different concentrations of Th1 lymphokines, the production of IFN-gamma and IL-2 was measured. It was observed that dendritic cells were more efficient than macrophages in stimulating lymphoproliferation in resistant mice. However, no significant difference was observed for IFN-gamma or IL-2 production. When cells from susceptible mice were used, macrophages were more efficient in stimulating lymphoproliferation than dendritic cells, but no difference was observed in the production of Th1 cytokine. Taken together, these results suggest the lower efficiency of dendritic cells and macrophages from B10.A mice in stimulating T cells that secrete Th1 lymphokines in vitro, an effect that may be involved in the progression of the disease in vivo.
Resumo:
Natural cell death is a well-known degenerative phenomenon occurring during development of the nervous system. The role of trophic molecules produced by target and afferent cells as well as by glial cells has been extensively demonstrated. Literature data demonstrate that cAMP can modulate the survival of neuronal cells. Cultures of mixed retinal cells were treated with forskolin (an activator of the enzyme adenylyl cyclase) for 48 h. The results show that 50 µM forskolin induced a two-fold increase in the survival of retinal ganglion cells (RGCs) in the absence of exogenous trophic factors. This effect was dose dependent and abolished by 1 µM H89 (an inhibitor of protein kinase A), 1.25 µM chelerythrine chloride (an inhibitor of protein kinase C), 50 µM PD 98059 (an inhibitor of MEK), 25 µM Ly 294002 (an inhibitor of phosphatidylinositol-3 kinase), 30 nM brefeldin A (an inhibitor of polypeptide release), and 10 µM genistein or 1 ng/ml herbimycin (inhibitors of tyrosine kinase enzymes). The inhibition of muscarinic receptors by 10 µM atropine or 1 µM telenzepine also blocked the effect of forskolin. When we used 25 µM BAPTA, an intracellular calcium chelator, as well as 20 µM 5-fluoro-2'-deoxyuridine, an inhibitor of cell proliferation, we also abolished the effect. Our results indicate that cAMP plays an important role controlling the survival of RGCs. This effect is directly dependent on M1 receptor activation indicating that cholinergic activity mediates the increase in RGC survival. We propose a model which involves cholinergic amacrine cells and glial cells in the increase of RGC survival elicited by forskolin treatment.
Resumo:
Cells usually lose adhesion and increase proliferation and migration during malignant transformation. Here, we studied how proliferation can affect the other two characteristics, which ultimately lead to invasion and metastasis. We determined the expression of ß1 integrins, as well as adhesion and migration towards laminin-1, fibronectin, collagens type I and type IV presented by LISP-1 colorectal cancer cells exposed to 2.5% dimethyl sulfoxide (DMSO), an agent capable of decreasing proliferation in this poorly differentiated colorectal cell line. Untreated cells (control), as shown by flow cytometry and monoclonal antibodies, expressed alpha2 (63.8 ± 11.3% positive cells), alpha3 (93.3 ± 7.0%), alpha5 (50.4 ± 12.0%) and alpha6 (34.1 ± 4.9%) integrins but not alpha1, alpha4, alphav or ß4. Cells adhered well to laminin-1 (73.4 ± 6.0%) and fibronectin (40.0 ± 2.0%) substrates but very little to collagens. By using blocking monoclonal antibodies, we showed that alpha2, alpha3 and alpha6 mediated laminin-1 adhesion, but neither alpha3 nor alpha5 contributed to fibronectin adherence. DMSO arrested cells at G0/G1 (control: 55.0 ± 2.4% vs DMSO: 70.7 ± 2.5%) while simultaneously reducing alpha5 (24.2 ± 19%) and alpha6 (14.3 ± 10.8%) expression as well as c-myc mRNA (7-fold), the latter shown by Northern blotting. Although the adhesion rate did not change after exposure to DMSO, alpha3 and alpha5 played a major role in laminin-1 and fibronectin adhesion, respectively. Migration towards laminin-1, which was clearly increased upon exposure to DMSO (control: 6 ± 2 cells vs DMSO: 64 ± 6 cells), was blocked by an antibody against alpha6. We conclude that the effects of DMSO on LISP-1 proliferation were accompanied by concurrent changes in the expression and function of integrins, consequently modulating adhesion/migration, and revealing a complex interplay between function/expression and the proliferative state of cells.
Resumo:
This paper describes the effect of dipyridamole (DIP) on the cytotoxicity of cisplatin in HEp-2 human larynx cancer cells in vitro and the nature of the interaction between cisplatin and dipyridamole. Cytotoxic assays were performed to obtain the IC50 for cisplatin. The cells were treated with 0, 20, 40, 80, 120 or 200 µM cisplatin, with or without a single concentration of DIP and incubated for 60 min at 37ºC and 5% CO2 for 3 days and then counted with a hemocytometer. The accumulation of cisplatin in the cells was measured by atomic absorption and fluorescence was used to determine the membrane binding constant of DIP. In the presence of 10, 20 and 30 µM DIP, the IC50 of cisplatin was reduced by 25, 60 and 82% in HEp-2 cells. Combination index analysis revealed that cisplatin and DIP interact synergistically. In larynx cancer cells, the accumulation of cisplatin increased by 13, 27 and 65% as the DIP concentration was increased from 10 to 20 and 30 µM, respectively. The binding constant of DIP to the cell membrane was estimated to be (0.36 ± 0.12 mg/ml)-1 (N = 2) by fluorescence and cisplatin did not suppress DIP fluorescence. These results suggest that DIP significantly enhances cisplatin cytotoxicity in HEp-2 cells by increasing cisplatin accumulation, probably by altering the cell membrane as suggested by its binding constant. The results obtained reinforce the importance of combination therapy to reduce the doses of chemotherapeutic drugs and therefore the side effects of chemotherapy.
Resumo:
The total number of CD34+ cells is the most relevant clinical parameter when selecting human umbilical cord blood (HUCB) for transplantation. The objective of the present study was to compare the two most commonly used CD34+ cell quantification methods (ISHAGE protocol and ProCount™ - BD) and analyze the CD34+ bright cells whose 7-amino actinomycin D (7AAD) analysis suggests are apoptotic or dead cells. Twenty-six HUCB samples obtained at the Placental Blood Program of New York Blood Center were evaluated. The absolute numbers of CD34+ cells evaluated by the ISHAGE (with exclusion of 7AAD+ cells) and ProCount™ (with exclusion of CD34+ bright cells) were determined. Using the ISHAGE protocol we found 35.6 ± 19.4 CD34+ cells/µL and with the ProCount™ method we found 36.6 ± 23.2 CD34+ cells/µL. With the ProCount™ method, CD34+ bright cell counts were 9.3 ± 8.2 cells/µL. CD34+ bright and regular cells were individually analyzed by the ISHAGE protocol. Only about 1.8% of the bright CD34+ cells are alive, whereas a small part (19.0%) is undergoing apoptosis and most of them (79.2%) are dead cells. Our study showed that the two methods produced similar results and that 7AAD is important to exclude CD34 bright cells. These results will be of value to assist in the correct counting of CD34+ cells and to choose the best HUCB unit for transplantation, i.e., the unit with the greatest number of potentially viable stem cells for the reconstitution of bone marrow. This increases the likelihood of success of the transplant and, therefore, the survival of the patient.
Resumo:
A correlation between cancer and prothrombotic states has long been described. More recently, a number of studies have focused on the procoagulant mechanisms exhibited by tumor cells. In the present study, we dissected the molecular mechanisms responsible for the procoagulant activity of MV3, a highly aggressive human melanoma cell line. It was observed that tumor cells strongly accelerate plasma coagulation as a result of: i) expression of the blood clotting initiator protein, a tissue factor, as shown by flow cytometry and functional assays (factor Xa formation in the presence of cells and factor VIIa), and ii) direct activation of prothrombin to thrombin by cells, as evidenced by hydrolysis of the synthetic substrate, S-2238, and the natural substrate, fibrinogen. This ability was highly potentiated by the addition of exogenous factor Va, which functions as a co-factor for the enzyme factor Xa. In contrast, prothrombin activation was not observed when cells were previously incubated with DEGR-factor Xa, an inactive derivative of the enzyme. Moreover, a monoclonal antibody against bovine factor Xa reduced the prothrombin-converting activity of tumor cells. In conclusion, the data strongly suggest that MV3 cells recruit factor Xa from the culture medium, triggering an uncommon procoagulant mechanism.
Resumo:
Hyperuricemia is associated with renal stones, not only consisting of uric acid (UrAc) but also of calcium oxalate (CaOx). Glycosaminoglycans (GAGs) are well-known inhibitors of growth and aggregation of CaOx crystals. We analyzed the effect of noncrystalline UrAc on GAG synthesis in tubular distal cells. MDCK (Madin-Darby canine kidney) cells were exposed to noncrystalline UrAc (80 µg/mL) for 24 h. GAGs were labeled metabolically and characterized by agarose gel electrophoresis. The expression of proteoglycans and cyclooxygenase 2 (COX-2) was assessed by real-time PCR. Necrosis, apoptosis and prostaglandin E2 (PGE2) were determined by acridine orange, HOESCHT 33346, and ELISA, respectively. CaOx crystal endocytosis was evaluated by flow cytometry. Noncrystalline UrAc significantly decreased the synthesis and secretion of heparan sulfate into the culture medium (UrAc: 2127 ± 377; control: 4447 ± 730 cpm) and decreased the expression of perlecan core protein (UrAc: 0.61 ± 0.13; control: 1.07 ± 0.16 arbitrary units), but not versican. Noncrystalline UrAc did not induce necrosis or apoptosis, but significantly increased COX-2 and PGE2 production. The effects of noncrystalline UrAc on GAG synthesis could not be attributed to inflammatory actions because lipopolysaccharide, as the positive control, did not have the same effect. CaOx was significantly endocytosed by MDCK cells, but this endocytosis was inhibited by exposure to noncrystalline UrAc (control: 674.6 ± 4.6, CaOx: 724.2 ± 4.2, and UrAc + CaOx: 688.6 ± 5.4 geometric mean), perhaps allowing interaction with CaOx crystals. Our results indicate that UrAc decreases GAG synthesis in MDCK cells and this effect could be related to the formation of UrAc and CaOx stones.
Resumo:
Infection with the protozoan parasite Trypanosoma cruzi leads to Chagas disease, which affects millions of people in Latin America. Infection with T. cruzi cannot be eliminated by the immune system. A better understanding of immune evasion mechanisms is required in order to develop more effective vaccines. During the acute phase, parasites replicate extensively and release immunomodulatory molecules that delay parasite-specific responses mediated by T cells. This immune evasion allows the parasite to spread in the host. In the chronic phase, parasite evasion relies on its replication strategy of hijacking the TGF-β signaling pathway involved in inflammation and tissue regeneration. In this article, the mechanisms of immune evasion described for T. cruzi are reviewed.
Resumo:
The combined treatment with histone deacetylase inhibitors (HDACi) and retinoids has been suggested as a potential epigenetic strategy for the control of cancer. In the present study, we investigated the effects of treatment with butyrate, a dietary HDACi, combined with vitamin A on MCF-7 human breast cancer cells. Cell proliferation was evaluated by the crystal violet staining method. MCF-7 cells were plated at 5 x 10(4) cells/mL and treated with butyrate (1 mM) alone or combined with vitamin A (10 µM) for 24 to 120 h. Cell proliferation inhibition was 34, 10 and 46% following treatment with butyrate, vitamin A and their combination, respectively, suggesting that vitamin A potentiated the inhibitory activities of butyrate. Furthermore, exposure to this short-chain fatty acid increased the level of histone H3K9 acetylation by 9.5-fold (Western blot), but not of H4K16, and increased the expression levels of p21WAF1 by 2.7-fold (Western blot) and of RARβ by 2.0-fold (quantitative real-time PCR). Our data show that RARβ may represent a molecular target for butyrate in breast cancer cells. Due to its effectiveness as a dietary HDACi, butyrate should be considered for use in combinatorial strategies with more active retinoids, especially in breast cancers in which RARβ is epigenetically altered.
Resumo:
Among the most common features of highly invasive tumors, such as lung adenocarcinomas (AD) and squamous cell carcinomas (SqCC), is the massive degradation of the extracellular matrix. The remarkable qualitative and quantitative modifications of hyaluronidases (HAases), hyaluronan synthases (HAS), E-cadherin adhesion molecules, and the transforming growth factor β (TGF-β) may favor invasion, cellular motility, and proliferation. We examined HAase proteins (Hyal), HAS, E-cadherin, and TGF-β profiles in lung AD subtypes and SqCC obtained from smokers and non-smokers. Fifty-six patients, median age 64 years, who underwent lobectomy for AD (N = 31) and SqCC (N = 25) were included in the study. HAS-1, -2 and -3, and Hyal-1 and -3 were significantly more expressed by tumor cells than normal and stroma cells (P < 0.01). When stratified according to histologic types, HAS-3 and Hyal-1 immunoreactivity was significantly increased in tumor cells of AD (P = 0.01) and stroma of SqCC (P = 0.002), respectively. Tobacco history in patients with AD was significantly associated with increased HAS-3 immunoreactivity in tumor cells (P < 0.01). Stroma cells of SqCC from non-smokers presented a significant association with HAS-3 (P < 0.01). Hyal, HAS, E-cadherin, and TGF-β modulate a different tumor-induced invasive pathway in lung AD subgroups and SqCC. HAases in resected AD and SqCC were strongly related to the prognosis. Therefore, our findings suggest that strategies aimed at preventing high HAS-3 and Hyal-1 synthesis, or local responses to low TGF-β and E-cadherin, may have a greater impact in lung cancer prognosis.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Type 2 diabetes mellitus (T2D) is a metabolic disease with inflammation as an important pathogenic background. However, the pattern of immune cell subsets and the cytokine profile associated with development of T2D are unclear. The objective of this study was to evaluate different components of the immune system in T2D patients' peripheral blood by quantifying the frequency of lymphocyte subsets and intracellular pro- and anti-inflammatory cytokine production by T cells. Clinical data and blood samples were collected from 22 men (51.6±6.3 years old) with T2D and 20 nonsmoking men (49.4±7.6 years old) who were matched for age and sex as control subjects. Glycated hemoglobin, high-sensitivity C-reactive protein concentrations, and the lipid profile were measured by a commercially available automated system. Frequencies of lymphocyte subsets in peripheral blood and intracellular production of interleukin (IL)-4, IL-10, IL-17, tumor necrosis factor-α, and interferon-γ cytokines by CD3+ T cells were assessed by flow cytometry. No differences were observed in the frequency of CD19+ B cells, CD3+CD8+ and CD3+CD4+ T cells, CD16+56+ NK cells, and CD4+CD25+Foxp3+ T regulatory cells in patients with T2D compared with controls. The numbers of IL-10- and IL-17-producing CD3+ T cells were significantly higher in patients with T2D than in controls (P<0.05). The frequency of interferon-γ-producing CD3+ T cells was positively correlated with body mass index (r=0.59; P=0.01). In conclusion, this study shows increased numbers of circulating IL-10- and IL-17-producing CD3+ T cells in patients with T2D, suggesting that these cytokines are involved in the immune pathology of this disease.
Resumo:
Granulomatous inflammation is the morphological substrate of a variety of important infectious diseases such as tuberculosis, leprosy, schistosomiasis and others. Nevertheless, although many aspects of this special type of inflammation are known, fundamental questions concerning granuloma formation, persistence, fate and significance for host-parasite relationships still remain to be elucidated. In this brief review, the basic and more relevant literature related to experimental investigations on granuloma physiopathology is presented. Based on recent investigations performed in our laboratory showing that MDF (Macrophage Deactivating Fator) secreted by epithelioid cells and characterized as the calcium-binding protein protein MRP-14 deactivates activated macrophages, a hypothesis to explain the persistence of granulomatous inflammation is put forward