69 resultados para tetraspore progeny


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Seventy-one isolines of Anopheles campestris-like were established from wild-caught females collected from human-biting and animal-biting traps at 12 locations in Thailand. All isolines had an average branch summation of seta 2-VI pupal skins ranging from 20.3-30.0 branches, which is in the range of An. campestris (17-58 branches). They showed three different karyotypes based on the amount of extra heterochromatin in the sex chromosomes, namely Forms B (X2, Y2), E (X1, X2, X3, Y5) and a new karyotypic Form F (X2, X3, Y6). Form B has been found only in Chaing Mai and Kamphaeng Phet populations, while Forms E and F are widely distributed throughout the species range. Genetic crosses between the 12 isolines, which were arbitrarily selected as representatives of An. campestris-like Forms B, E and F, revealed genetic compatibility that provided viable progeny through F2 generations, suggesting a conspecific nature of these karyotypic forms. These results are supported by the very low intraspecies variation (genetic distance < 0.005) of ITS2, COI and COII from genomic DNA of the three karyotypic forms.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Aedes albopictus was responsible for transmission in the first outbreak of chikungunya (CHIK) on La Réunion Island, Indian Ocean, in 2005-2006. The magnitude of the outbreak on this island, which had been free of arboviral diseases for over 30 years, as well as the efficiency of Ae. albopictus as the main vector, raises questions about the maintenance of the CHIK virus (CHIKV) through vertical transmission mechanisms. Few specimens collected from the field as larvae were found to be infected. In this study, Ae. albopictus originating from La Réunion were orally infected with a blood-meal containing 10(8) pfu/mL of the CHIKV epidemic strain (CHIKV 06.21). Eggs from the first and second gonotrophic cycles were collected and raised to the adult stage. The infectious status of the progeny was checked (i) by immunofluorescence on head squashes of individual mosquitoes to detect the presence of viral particles or (ii) by quantitative RT-PCR on mosquito pools to detect viral RNA. We analysed a total of 1,675 specimens from the first gonotrophic cycle and 1,709 from the second gonotrophic cycle without detecting any viral particles or viral RNA. These laboratory results are compared to field records.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Although the genome of Trypanosoma cruzi has been completely sequenced, little is known about its population structure and evolution. Since 1999, two major evolutionary lineages presenting distinct epidemiological characteristics have been recognised: T. cruzi I and T. cruzi II. We describe new and important aspects of the population structure of the parasite, and unequivocally characterise a third ancestral lineage that we propose to name T. cruzi III. Through a careful analysis of haplotypes (blocks of genes that are stably transmitted from generation to generation of the parasite), we inferred at least two hybridisation events between the parental lineages T. cruzi II and T. cruzi III. The strain CL Brener, whose genome was sequenced, is one such hybrid. Based on these results, we propose a simple evolutionary model based on three ancestral genomes, T. cruzi I, T. cruzi II and T. cruzi III. At least two hybridisation events produced evolutionarily viable progeny, and T. cruzi III was the cytoplasmic donor for the resulting offspring (as identified by the mitochondrial clade of the hybrid strains) in both events. This model should be useful to inform evolutionary and pathogenetic hypotheses regarding T. cruzi.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this study, we looked at the inheritance of susceptibility and resistance to Schistosoma mansoni infection in the first generation of crossbred Biomphalaria alexandrina snails. Our ultimate goal is to use such information to develop a biological method of controlling schistosomiasis. We infected laboratory-bred snails with S. mansoni miracidia and examined cercarial shedding to determine susceptibility and resistance. Five parental groups were used: Group I contained 30 susceptible snails, Group II contained 30 resistant snails, Group III contained 15 susceptible and 15 resistant snails, Group IV contained 27 susceptible and three resistant snails and Group V contained three susceptible and 27 resistant snails. The percentage of resistant snails in the resulting progeny varied according to the ratio of susceptible and resistant parents per group; they are 7%, 100%, 68%, 45% and 97% from Groups I, II, III, IV and V, respectively. On increasing the percentage of resistant parent snails, the percentage of resistant progeny increased, while cercarial production in their susceptible progeny decreased.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The morphologically similar taxa Anopheles calderoni, Anopheles punctimacula, Anopheles malefactor and Anopheles guarao are commonly misidentified. Isofamilies collected in Valle de Cauca, Colombia, showed morphological characters most similar to An. calderoni, a species which has never previously been reported in Colombia. Although discontinuity of the postsubcostal pale spots on the costa (C) and first radial (R1) wing veins is purportedly diagnostic for An. calderoni, the degree of overlap of the distal postsubcostal spot on C and R1 were variable in Colombian specimens (0.003-0.024). In addition, in 98.2% of larvae, seta 1-X was located off the saddle and seta 3-C had 4-7 branches in 86.7% of specimens examined. Correlation of DNA sequences of the second internal transcribed spacer and mtDNA cytochrome c oxidase subunit I gene (COI) barcodes (658 bp of the COI gene) generated from Colombian progeny material and wild-caught mosquitoes from Ecuador with those from the Peruvian type series of An. calderoni confirmed new country records. DNA barcodes generated for the closely related taxa, An. malefactor and An. punctimacula are also presented for the first time. Examination of museum specimens at the University of the Valle, Colombia, revealed the presence of An. calderoni in inland localities across Colombia and at elevations up to 1113 m.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In the present study, Biomphalaria snails collected from five Egyptian governorates (Giza, Fayoum, Kafr El-Sheikh, Ismailia and Damietta), as well as reference control Biomphalaria alexandrina snails from the Schistosome Biological Supply Center (SBSC) (Theodor Bilharz Research Institute, Egypt), were subjected to species-specific polymerase chain reaction (PCR) assays to identify the collected species. All of the collected snails were found to be B. alexandrina and there was no evidence of the presence of Biomphalaria glabrata. Randomly amplified polymorphic DNA (RAPD)-PCR assays showed different fingerprints with varying numbers of bands for the first generation (F1) of B. alexandrina snail populations (SBSC, Giza, Fayoum, Kafr El-Sheikh, Ismailia and Damietta). The primer OPA-1 produced the highest level of polymorphism and amplified the greatest number of specific bands. The estimated similarity coefficients among the B. alexandrina populations based on the RAPD-PCR profiles ranged from 0.56 (between SBSC and Ismailia snails) to 0.72 (between Ismailia and Kafr El-Sheikh snails). Experimental infection of the F1 of progeny from the collected snails with Schistosoma mansoni (SBSC strain) showed variable susceptibility rates ranging from 15% in the Fayoum snail group to 50.3% in SBSC snails. A negative correlation was observed between the infection rates in the different snail groups and the distances separating their corresponding governorates from the parasite source. The infection rates of the snail groups and their similarity coefficients with SBSC B. alexandrina snails were positively correlated. The variations in the rates of infection of different B. alexandrina groups with S. mansoni, as well as the differences in the similarity coefficients among these snails, are dependent not only on the geographical distribution of the snails and the parasite, but also on the genetic variability of the snails. Introduction of this variability into endemic areas may reduce the ability of the parasite to infect local hosts and consequently reduce schistosomiasis epidemiology.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Trichogramma atopovirilia Oatman & Platner is an egg parasitoid of the corn earworm Helicoverpa zea (Boddie) (Lepidoptera, Noctuidae), and has recently been collected from eggs of Anticarsia gemmatalis Hübner on soybeans. In order to evaluate the suitability of A. gemmatalis eggs as hosts of T. atopovirilia, field surveys were conducted in 1999 and 2000 on corn and soybeans, and a colony of the parasitoid was established in laboratory. At 25 ºC, development from oviposition to emergence lasted nine days and a sex-ratio of 0.58 (females:males) was obtained. Females lived significantly longer (11.4 days) when kept in ovipositional activity, than in the absence of host eggs (6.6 days). Total fecundity averaged 104.5 parasitized eggs, resulting in the emergence of 138.3 descendents. Mean daily fecundity was highest (30 eggs/female) on the first day. Oviposition continued until one day before the death of the females, however 70% of the eggs were laid during the first four days after emergence. A female-biased progeny was produced during the first three days of oviposition, whereas further ovipositions were male-biased. Females lived significantly longer when exposed to host eggs in comparison to females deprived of eggs. The results show that eggs of A. gemmatalis are suitable for the development of T. atopovirilia, and this parasitoid should be considered in future programs of biological control of the velvetbean caterpillar.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study aimed at evaluating the biological characteristics and the capacity of parasitism of a Trichogramma pretiosum Riley, 1869 (Hymenoptera, Trichogrammatidae) strain (T. pretiosum RV) collected in Rio Verde County, State of Goiás, Brazil. The study was carried out on eggs of Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera, Noctuidae) and conducted under controlled environmental conditions at different constant temperatures. The biological parameters determined were: developmental time (egg-adult; days); emergence (%); sex ratio; number of progeny/egg; number of generation/year; thermal constant (K); temperature threshold (Tb); daily number of parasitized eggs; cumulative parasitism (%); total number of eggs parasitized by T. pretiosum; and female longevity. To study the T. pretiosum parasitism capacity, 20 S. frugiperda eggs (< 24 h old) were placed into 8.0 cm x 2.0 cm glass vials containing one female (< 24 h old) each. Trials were carried out in a completely randomized experimental design, with 20 replications at each temperature. The environmental chambers (BOD type) were set at 18ºC, 20ºC, 22ºC, 25ºC, 28ºC and 32ºC ± 1ºC, 70 ±10% relative humidity, and 14/10 h (L:D) photoperiod. The eggs of S. frugiperda were replaced daily until parasitoid death. Results have shown an inverse correlation between developmental time and temperature, with statistically significant differences among means, except at 25ºC and 28ºC (10 days). Parasitoid emergence (%) was also influenced by temperature. The lowest percent emergence was observed at 32ºC, and the highest ones at 18ºC and 20ºC temperatures. The temperature did not affect T. pretiosum sex ratio and number of parasitoids per egg, thus allowing changes in the temperature to control insect mass production in the laboratory to meet the needs for field releases.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Bioactivity of Indonesian mahogany, Toona sureni (Blume) (Meliaceae), against the red flour beetle, Tribolium castaneum (Coleoptera, Tenebrionidae). The insecticidal activity of Toona sureni (Blume) Merr. was evaluated considering repellency, mortality and progeny production of F1 adults of Tribolium castaneum (Herbst, 1797) (Coleoptera, Tenebrionidae). Dried extract of seeds of T. sureni was dissolved in acetone to prepare solution of various concentrations (0.5, 1.0, 2.5 and 5.0%). To test for repellency, the insects were exposed to treated filter paper. Mortality of larvae, pupae and adults was evaluated by the treatment of spraying the insects with different concentrations of T. sureni extract. Residual effect of the extract was also evaluated considering the production of progeny of F1 adults. The highest repellency (93.30%) of T. castaneum occurred at the highest concentration (5.0% suspension of T. sureni); while the lowest (0.0%) repellency occurred at 0.5% suspension after 1 day of treatment. The highest mortality against adults (86.71%), larvae (88.32%) and pupae (85%) occurred at 5% suspension at 8 days after application. There was a negative correlation between the concentrations of T. sureni and the production of F1 adult's progeny of T. castaneum. The highest number of progeny (147) of T. castaneum occurred in the control at 7 days after treatment; and the lowest number of progeny (43) occurred at 5.0% concentration in 1 day after treatment. The results show that T. sureni is toxic to T. castaneum and has the potential to control all stages of this insect in stored wheat.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Arcelin is a seed protein found in wild beans (Phaseolus vulgaris) which gives resistance to Mexican bean weevil, Zabrotes subfasciatus (Boheman 1833) (Coleoptera: Bruchidae). Studies were carried out with the objective of estimating the effect of four alleles of protein arcelin (Arc1, Arc2, Arc3 and Arc4) on the biology of Z. subfasciatus. The experiment was carried out in laboratory at Embrapa-Centro Nacional de Pesquisa de Arroz e Feijão, in Santo Antônio de Goiás, GO, Brazil, under non controlled conditions. The highest levels of antibiosis to Z. subfasciatus were observed in Arc1, with reduction in the number of eggs, number of emerged adults, adults longevity. In the line Arc2 only reduction in the number of emerged adults was observed. The lines Arc3 and Arc4 showed low efficiency on the reduction of progeny of Z. subfasciatus and effects in the longevity and egg-adult cycle were not detected. Insect sexual ratio was not altered by the presence of Arc1, Arc2, Arc3 and Arc4 in the seeds.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Soybean yield is highly affected by sowing period and there are significant productivity losses when sowings are done outward a relatively restricted period in many regions of Brazil. Breeding cultivars less sensitive to photoperiod and to temperature variations is desirable for adaptation to wider sowing period and wider latitude range and also make irrigated soybean cultivation possible during the fall-winter seasons in frost free regions. The possibility of selecting high yielding and stable lines for yield during various sowing periods was studied by analyzing the behavior of 100 non-selected advanced lines (F9 and F10), from each one of all possible biparental crosses involving the genotypes BR85-29009, OCEPAR 8, FT-2, and BR-13. Experiments were set up in a completely randomized design with single-plant hill plots and received supplementary irrigation. Sowing was on Sept 27, Oct 20, Nov 17, and Dec 17 in 1993/94 and Sept 20, Oct 20, Nov 17, and Dec 14 in 1994/95 at Londrina, PR, Brazil. Procedures of regression analysis and minimum variance among planting date means were efficient for selecting stable lines during the four sowing seasons. It was possible to select stable and high yielding genotypes through the four sowing periods in all the crosses. No specific cross was clearly better to produce a greater number of stable genotypes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to evaluate the processes of selection in a citrus hybrid population using segregation analysis of RAPD markers. The segregation of 123 RAPD markers between 'Cravo' mandarin (Citrus reticulata Blanco) and 'Pêra' sweet orange (C. sinensis (L.) Osbeck) was analysed in a F1 progeny of 94 hybrids. Genetic composition, diversity, heterozygosity, differences in chromosomal structure and the presence of deleterious recessive genes are discussed based on the segregation ratios obtained. A high percentage of markers had a skeweness of the 1:1 expected segregation ratio in the F1 population. Many markers showed a 3:1 segregation ratio in both varieties and 1:3 in 'Pêra' sweet orange, probably due to directional selection processes. The distribution analysis of the frequencies of the segregant markers in a hybrid population is a simple method which allows a better understanding of the genetics of citrus group.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to construct linkage maps of 'Pêra' sweet orange [Citrus sinensis (L.) Osbeck] and 'Cravo' mandarin (Citrus reticulata Blanco) using RAPD markers and the pseudo-testcross strategy. The parents were chosen according to the resistance/susceptibility to citrus variegate chlorosis (CVC). The segregation of 176 markers was analyzed in 94 progeny of F1 hybrids, which were obtained from controlled crossings. The linkage map of 'Pêra' sweet orange had 117 markers defined by 12 linkage groups, which spanned 612.1 cM. Only six markers could not be linked to the linkage group and 48.7% of the markers showed segregation distortion. The linkage map of 'Cravo' mandarin had 51 markers defined by 12 linkage groups, which spanned 353.3 cM. Only two markers did not link to the groups and 15.7% showed segregation distortion. The construction of linkage maps is relevant to future mapping studies of the inheritance of CVC, citrus canker and leprosis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objectives of this work were to estimate the genetic and phenotypic parameters and to predict the genetic and genotypic values of the selection candidates obtained from intraspecific crosses in Panicum maximum as well as the performance of the hybrid progeny of the existing and projected crosses. Seventy-nine intraspecific hybrids obtained from artificial crosses among five apomictic and three sexual autotetraploid individuals were evaluated in a clonal test with two replications and ten plants per plot. Green matter yield, total and leaf dry matter yields and leaf percentage were evaluated in five cuts per year during three years. Genetic parameters were estimated and breeding and genotypic values were predicted using the restricted maximum likelihood/best linear unbiased prediction procedure (REML/BLUP). The dominant genetic variance was estimated by adjusting the effect of full-sib families. Low magnitude individual narrow sense heritabilities (0.02-0.05), individual broad sense heritabilities (0.14-0.20) and repeatability measured on an individual basis (0.15-0.21) were obtained. Dominance effects for all evaluated characteristics indicated that breeding strategies that explore heterosis must be adopted. Less than 5% increase in the parameter repeatability was obtained for a three-year evaluation period and may be the criterion to determine the maximum number of years of evaluation to be adopted, without compromising gain per cycle of selection. The identification of hybrid candidates for future cultivars and of those that can be incorporated into the breeding program was based on the genotypic and breeding values, respectively. The prediction of the performance of the hybrid progeny, based on the breeding values of the progenitors, permitted the identification of the best crosses and indicated the best parents to use in crosses.