Erythrovirus B19 infection in acquired immunodeficiency syndrome: screening by histopathology, immunohistochemistry, and in situ hybridization

Erythrovirus B19 infects erythrocytic progenitors, transiently interrupting erythropoiesis. In AIDS patients it causes chronic anemia amenable to treatment. We looked for evidences of B19 infection in stored bone marrow material from patients with acquired immunodeficiency syndrome. Histological sections were made from stored paraffin blocks from 33 autopsies (39 blocks) and 35 biopsies (45 blocks, 30 patients) performed from 1988 to 2002. They were examined after hematoxylin-eosin (HE) staining, immunohistochemical (IHC), and in situ hybridization. HE revealed intra-nuclear inclusion bodies ("lantern cells") suggesting B19 infection in 19 sections corresponding to 19 of 63 patients examined with this test. Seven of 78 sections subjected to immunohistochemistry were positive, corresponding to 7 of 58 patients examined with this test. Fourteen sections corresponding to 13 of the 20 HE and/or IHC positive patients were subjected to in situ hybridization, with six positives results. Among the 13 patients subjected to the three techniques, only one gave unequivocal positive results in all and was considered a true positive. The frequency of B19 infection (1/63 patients) in the material examined can be deemed low.

A bacterial artificial chromosome library for Biomphalaria glabrata, intermediate snail host of Schistosoma mansoni

To provide a novel resource for analysis of the genome of Biomphalaria glabrata, members of the international Biomphalaria glabrata Genome Initiative (biology.unm.edu/biomphalaria-genome.html), working with the Arizona Genomics Institute (AGI) and supported by the National Human Genome Research Institute (NHGRI), produced a high quality bacterial artificial chromosome (BAC) library. The BB02 strain B. glabrata, a field isolate (Belo Horizonte, Minas Gerais, Brasil) that is susceptible to several strains of Schistosoma mansoni, was selfed for two generations to reduce haplotype diversity in the offspring. High molecular weight DNA was isolated from ovotestes of 40 snails, partially digested with HindIII, and ligated into pAGIBAC1 vector. The resulting B. glabrata BAC library (BG_BBa) consists of 61824 clones (136.3 kb average insert size) and provides 9.05 × coverage of the 931 Mb genome. Probing with single/low copy number genes from B. glabrata and fingerprinting of selected BAC clones indicated that the BAC library sufficiently represents the gene complement. BAC end sequence data (514 reads, 299860 nt) indicated that the genome of B. glabrata contains ~ 63% AT, and disclosed several novel genes, transposable elements, and groups of high frequency sequence elements. This BG_BBa BAC library, available from AGI at cost to the research community, gains in relevance because BB02 strain B. glabrata is targeted whole genome sequencing by NHGRI.

Detection of rifampin-resistant genotypes in Mycobacterium tuberculosis by reverse hybridization assay

We used a colorimetric reverse dot blot hybridization (CRDH) assay to detect the presence of mutations in a specific region of the rpoB gene, associated with rifampin (RIF) resistance, in a panel of 156 DNAs extracted from 103 RIF-sensitive and 53 RIF-resistant cultures of Mycobacterium tuberculosis. When compared with the antimicrobial susceptibility test (AST), the sensitivity and specificity of the CRDH were 92.3% and 98.1%, respectively. When compared with sequencing, the sensitivity and specificity of the CRDH were 90.6% and 100%, respectively. To evaluate the performance of the assay directly in clinical specimens, 30 samples from tuberculosis patients were used. For these samples, the results of the CRDH were 100% consistent with the results of the AST and sequencing. These results indicate that the rate of concordance of the CRDH is high when compared to conventional methods and sequencing data. The CRDH can be successfully applied when a rapid test is required for the identification of RIF resistance in M. tuberculosis.

Colorimetric microwell plate reverse-hybridization assay for Mycobacterium tuberculosis detection

Direct smear examination using Ziehl-Neelsen staining for pulmonary tuberculosis (PTB) diagnosis is inexpensive and easy to use, but has the major limitation of low sensitivity. Rapid molecular methods are becoming more widely available in centralized laboratories, but they depend on timely reporting of results and strict quality assurance obtainable only from costly commercial kits available in high burden nations. This study describes a pre-commercial colorimetric method, Detect-TB, for detecting Mycobacterium tuberculosis DNA in which an oligonucleotide probe is fixed onto wells of microwell plates and hybridized with biotinylated polymerase chain reaction amplification products derived from clinical samples. The probe is capable of hybridising with the IS6110 insertion element and was used to specifically recognise the M. tuberculosis complex. When combined with an improved silica-based DNA extraction method, the sensitivity of the test was 50 colony-forming units of the M. tuberculosis reference strain H37Rv. The results that were in agreement with reference detection methods were observed in 95.2% (453/476) of samples included in the analysis. Sensitivity and specificity for 301 induced sputum samples and 175 spontaneous sputum samples were 85% and 98%, and 94% and 100%, respectively. This colorimetric method showed similar specificity to that described for commercially available kits and may provide an important contribution for PTB diagnosis.

Large indoor cage study of the suppression of stable Aedes aegypti populations by the release of thiotepa-sterilised males

The sterile insect technique (SIT) is a promising pest control method in terms of efficacy and environmental compatibility. In this study, we determined the efficacy of thiotepa-sterilised males in reducing the target Aedes aegypti populations. Treated male pupae were released weekly into large laboratory cages at a constant ratio of either 5:1 or 2:1 sterile-to-fertile males. A two-to-one release ratio reduced the hatch rate of eggs laid in the cage by approximately a third and reduced the adult catch rate by approximately a quarter, but a 5:1 release drove the population to elimination after 15 weeks of release. These results indicate that thiotepa exposure is an effective means of sterilising Ae. aegypti and males thus treated are able to reduce the reproductive capacity of a stable population under laboratory conditions. Further testing of the method in semi-field enclosures is required to evaluate the mating competitiveness of sterile males when exposed to natural environmental conditions. If proven effective, SIT using thiotepa-sterilised males may be incorporated into an integrated programme of vector control to combat dengue in Cuba.

Soil spectral library and its use in soil classification

Soil science has sought to develop better techniques for the classification of soils, one of which is the use of remote sensing applications. The use of ground sensors to obtain soil spectral data has enabled the characterization of these data and the advancement of techniques for the quantification of soil attributes. In order to do this, the creation of a soil spectral library is necessary. A spectral library should be representative of the variability of the soils in a region. The objective of this study was to create a spectral library of distinct soils from several agricultural regions of Brazil. Spectral data were collected (using a Fieldspec sensor, 350-2,500 nm) for the horizons of 223 soil profiles from the regions of Matão, Paraguaçu Paulista, Andradina, Ipaussu, Mirandópolis, Piracicaba, São Carlos, Araraquara, Guararapes, Valparaíso (SP); Naviraí, Maracajú, Rio Brilhante, Três Lagoas (MS); Goianésia (GO); and Uberaba and Lagoa da Prata (MG). A Principal Component Analysis (PCA) of the data was then performed and a graphic representation of the spectral curve was created for each profile. The reflectance intensity of the curves was principally influenced by the levels of Fe2O3, clay, organic matter and the presence of opaque minerals. There was no change in the spectral curves in the horizons of the Latossolos, Nitossolos, and Neossolos Quartzarênicos. Argissolos had superficial horizon curves with the greatest intensity of reflection above 2,200 nm. Cambissolos and Neossolos Litólicos had curves with greater reflectance intensity in poorly developed horizons. Gleisols showed a convex curve in the region of 350-400 nm. The PCA was able to separate different data collection areas according to the region of source material. Principal component one (PC1) was correlated with the intensity of reflectance samples and PC2 with the slope between the visible and infrared samples. The use of the Spectral Library as an indicator of possible soil classes proved to be an important tool in profile classification.

Building the future: the Brazilian university library in 2010

Information technology will affect academic activities as well as the nature of the high education sector. This sector besides the need to assimilate these technologies will need to attend the requisites of market globalization and, as consequence, all theses changes will be reflected in the university library. Prospectives impacts will affect the structure (emphasis in user services, outsourcing of several services), in the financing aspect (growing of consortia in order to reduce costs), in services (electronic reference, support to long distance education programs, intelligent agents) and in the clientele (attending the great demand por high education which implies a diversity of people).

Technology and research in a global Networked University Digital Library (NUDL)

Digital Libraries (DLs) are extremely complex information systems that support the creation, management, distribution, and preservation of complex information resources, while allowing effective and efficient interaction among the several societies that benefit from DL content and services. In this paper, we focus on our experience facing challenges of building, maintaining, and developing the Networked University Digital Library (www.nudl.org), an extension of the Networked Digital Library of Theses and Dissertations (www.ndltd.org). NUDL is a worldwide initiative that addresses making the intellectual property produced in universities more accessible, stimulating international collaboration across all disciplines. We detail technological aspects of our solutions and research activities carried out to provide powerful and enriched services for the communities served by this initiative.

A model of multilingual digital library

This paper addresses the problem of multilingual digital libraries. The motivation for a such a digital library comes from the diversity of languages of the Internet users as well as the diversity of content authors, from e-book authors to writers of courseware. The basic definitions of such a system, the specifications of its functionality and the identification of the items it holds are discussed. The impact of multilinguism in each of the former aspects is presented. A case study of a multilingual digital library - in the Maxwell System in PUC-Rio - is described in the last sections. Its main characteristics are described and the current status of its digital library is shown.

Working in a digital world: new leadership practices for the development of a digital library workforce

Digital library developments are part of a global move in many sectors of society toward virtual work and electronic services made possible by the advances in information technology. This environment requires new attitudes and skills in the workforce and therefore leaders who understand the global changes underlying the new information economy and how to lead and develop such a workforce. This article explores ways to develop human resources and stimulate creativity to capitalize on the immense potential of digital libraries to educate and empower social change. There is a shortage of technically skilled workers and even more so of innovators. Retention and recruitment is one of the greatest obstacles to developing digital library services and information products.

The Brazilian electronic theses and dissertations digital library: providing open access for scholarly information

This paper describes a project led by the Instituto Brasileiro de Informações em Ciência e Tecnologia (Ibict), a government institution, to build a national digital library for electronic theses and dissertations - Bibliteca Digital de Teses e Dissertações (BDTD). The project has been a collaborative effort among Ibict, universities and other research centers in Brazil. The developers adopted a system architecture based on the Open Archives Initiative (OAI) in which universities and research centers act as data providers and Ibict as a service provider. A Brazilian metadata standard for electronic theses and dissertations was developed for the digital library. A toolkit including open source package was also developed by Ibict to be distributed to potential data providers. BDTD has been integrated with the international initiative: the Networked Digital Library of Thesis and Dissertation (NDLTD). Discussions in the paper address various issues related to project design, development and management as well as the role played by Ibict. Conclusions highlight some important lessons learned to date and challenges for the future in expanding the BDTD project.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins

In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp.) skin, Desmodium ovalifolium, red grape (Vitis vinifera) skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (P<0.01) when the controls were compared to either buffer treatments due to tannin type, buffer used and the interaction of tannin type and buffer. The significant interaction indicates the influence of tannin type on the parameters evaluated.