42 resultados para paralinguistic expressions
Resumo:
Serotonin has been implicated in the neurobiology of depressive and anxiety disorders, but little is known about its role in the modulation of basic emotional processing. The aim of this study was to determine the effect of the selective serotonin reuptake inhibitor, escitalopram, on the perception of facial emotional expressions. Twelve healthy male volunteers completed two experimental sessions each, in a randomized, balanced order, double-blind design. A single oral dose of escitalopram (10 mg) or placebo was administered 3 h before the task. Participants were presented to a task composed of six basic emotions (anger, disgust, fear, happiness, sadness, and surprise) that were morphed between neutral and each standard emotion in 10% steps. Escitalopram facilitated the recognition of sadness and inhibited the recognition of happiness in male, but not female faces. No drug effect on subjective measures was detected. These results confirm that serotonin modulates the recognition of emotional faces, and suggest that the gender of the face can have a role in this modulation. Further studies including female volunteers are needed.
Resumo:
There is no index or criterion of aortic barodenervation, nor can we differentiate among rats that have suffered chronic sham, aortic or sino-aortic denervation. The objective of this study was to develop a procedure to generate at least one quantitative, reproducible and validated index that precisely evaluates the extent of chronic arterial barodenervation performed in conscious rats. Data from 79 conscious male Wistar rats of about 65-70 days of age with diverse extents of chronic arterial barodenervation and used in previous experiments were reanalyzed. The mean arterial pressure (MAP) and the heart rate (HR) of all rats were measured systematically before (over 1 h) and after three consecutive iv bolus injections of phenylephrine (PHE) and sodium nitroprusside (SNP). Four expressions of the effectiveness of barodenervation (MAP lability, PHE ratio, SNP ratio, and SNP-PHE slope) were assessed with linear fixed models, three-level average variance, average separation among levels, outlier box plot analysis, and overlapping graphic analysis. The analysis indicated that a) neither MAP lability nor SNP-PHE slope was affected by the level of chronic sodium intake; b) even though the Box-Cox transformations of both MAP lability [transformed lability index (TLI)] and SNP-PHE slope [transformed general sensitivity index (TGSI), {((3-(ΔHRSNP-ΔHRPHE/ΔMAPSNP-ΔMAPPHE))-0.4-1)/-0.04597}] could be two promising indexes, TGSI proved to be the best index; c) TLI and TGSI were not freely interchangeable indexes for this purpose. TGSI ranges that permit differentiation between sham (10.09 to 11.46), aortic (8.40 to 9.94) and sino-aortic (7.68 to 8.24) barodenervated conscious rats were defined.
Resumo:
The objective of this study was to evaluate the effects of tetramethylpyrazine (TMP) in combination with arsenic trioxide (As2O3) on the proliferation and differentiation of HL-60 cells. The HL-60 cells were treated with 300 µg/mL TMP, 0.5 µM As2O3, and 300 µg/mL TMP combined with 0.5 µM As2O3, respectively. The proliferative inhibition rates were determined with MTT. Differentiation was detected by the nitroblue tetrazolium (NBT) reduction test, Wright’s staining and the distribution of CD11b and CD14. Flow cytometry was used to analyze cell cycle distribution. RT-PCR and Western blot assays were employed to detect the expressions of c-myc, p27, CDK2, and cyclin E1. Combination treatment had synergistic effects on the proliferative inhibition rates. The rates were increased gradually after the combination treatment, much higher than those treated with the corresponding concentration of As2O3 alone. The cells exhibited characteristics of mature granulocytes and a higher NBT-reducing ability, being a 2.6-fold increase in the rate of NBT-positive ratio of HL-60 cells within the As2O3 treatment versus almost a 13-fold increase in the TMP + As2O3 group. Cells treated with both TMP and As2O3 expressed far more CD11b antigens, almost 2-fold compared with the control group. Small doses of TMP potentiate As2O3-induced differentiation of HL-60 cells, possibly by regulating the expression and activity of G0/G1 phase-arresting molecules. Combination treatment of TMP with As2O3 has significant synergistic effects on the proliferative inhibition of HL-60 cells.
Resumo:
Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.
Resumo:
The present study focuses on the neuroprotective effect of glycyrrhizic acid (GA, a major compound separated from Glycyrrhiza Radix, which is a crude Chinese traditional drug) against glutamate-induced cytotoxicity in differentiated PC12 (DPC12) cells. The results showed that GA treatment improved cell viability and ameliorated abnormal glutamate-induced alterations in mitochondria in DPC12 cells. GA reversed glutamate-suppressed B-cell lymphoma 2 levels, inhibited glutamate-enhanced expressions of Bax and cleaved caspase 3, and reduced cytochrome C (Cyto C) release. Exposure to glutamate strongly inhibited phosphorylation of AKT (protein kinase B) and extracellular signal-regulated kinases (ERKs); however, GA pretreatment enhanced activation of ERKs but not AKT. The presence of PD98059 (a mitogen-activated protein/extracellular signal-regulated kinase kinase [MEK] inhibitor) but not LY294002 (a phosphoinositide 3-kinase [PI3K] inhibitor) diminished the potency of GA for improving viability of glutamate-exposed DPC12 cells. These results indicated that ERKs and mitochondria-related pathways are essential for the neuroprotective effect of GA against glutamate-induced toxicity in DPC12 cells. The present study provides experimental evidence supporting GA as a potential therapeutic agent for use in the treatment of neurodegenerative diseases.
Resumo:
People who suffer from traumatic brain injury (TBI) often experience cognitive deficits in spatial reference and working memory. The possible roles of cyclooxygenase-1 (COX-1) in learning and memory impairment in mice with TBI are far from well known. Adult mice subjected to TBI were treated with the COX-1 selective inhibitor SC560. Performance in the open field and on the beam walk was then used to assess motor and behavioral function 1, 3, 7, 14, and 21 days following injury. Acquisition of spatial learning and memory retention was assessed using the Morris water maze on day 15 post-TBI. The expressions of COX-1, prostaglandin E2 (PGE2), interleukin (IL)-6, brain-derived neurotrophic factor (BDNF), platelet-derived growth factor BB (PDGF-BB), synapsin-I, and synaptophysin were detected in TBI mice. Administration of SC560 improved performance of beam walk tasks as well as spatial learning and memory after TBI. SC560 also reduced expressions of inflammatory markers IL-6 and PGE2, and reversed the expressions of COX-1, BDNF, PDGF-BB, synapsin-I, and synaptophysin in TBI mice. The present findings demonstrated that COX-1 might play an important role in cognitive deficits after TBI and that selective COX-1 inhibition should be further investigated as a potential therapeutic approach for TBI.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
We collected a series of 136 lung/bronchial and 56 matched lung parenchyma tissue samples from patients who underwent lung/bronchial biopsies and presented invasive carcinoma after lung surgery. The lung/bronchial samples included basal cell hyperplasia, squamous metaplasia, moderate dysplasia, adenomatous hyperplasia, severe dysplasia, squamous cell carcinoma and adenocarcinoma. Matched lung parenchyma tissue samples included 25 squamous cell carcinomas and 31 adenocarcinomas. Immunohistochemistry was performed to analyze for the distribution of hyaluronidase (Hyal)-1 and −3, and hyaluronan synthases (HAS)-1, −2, and −3. Hyal-1 showed significantly higher expression in basal cell hyperplasia than in moderate dysplasia (P=0.01), atypical adenomatous hyperplasia (P=0.0001), or severe dysplasia (P=0.03). Lower expression of Hyal-3 was found in atypical adenomatous hyperplasia than in basal cell hyperplasia (P=0.01) or moderate dysplasia (P=0.02). HAS-2 was significantly higher in severe dysplasia (P=0.002) and in squamous metaplasia (P=0.04) compared with basal cell hyperplasia. HAS-3 was significantly expressed in basal cell hyperplasia compared with atypical adenomatous hyperplasia (P=0.05) and severe dysplasia (P=0.02). Lower expression of HAS-3 was found in severe dysplasia compared with squamous metaplasia (P=0.01) and moderate dysplasia (P=0.01). Epithelial Hyal-1 and −3 and HAS-1, −2, and −3 expressions were significantly higher in pre-neoplastic lesions than in neoplastic lesions. Comparative Cox multivariate analysis controlled by N stage and histologic tumor type showed that patients with high HAS-3 expression in pre-neoplastic cells obtained by lung/bronchial biopsy presented a significantly higher risk of death (HR=1.19; P=0.04). We concluded that localization of Hyal and HAS in lung/bronchial pre-neoplastic and neoplastic lesions was inversely related to malignancy, which implied that visualizing these factors could be a useful diagnostic procedure for suspected lung cancer. Finalizing this conclusion will require a wider study in a randomized and prospective trial.
Resumo:
Diabetic retinopathy (DR) is a serious complication of diabetes mellitus that may result in blindness. We evaluated the effects of activation of endogenous angiotensin converting enzyme (ACE) 2 on the early stages of DR. Rats were administered an intravenous injection of streptozotocin to induce hyperglycemia. The ACE2 activator 1-[[2-(dimethylamino) ethyl] amino]-4-(hydroxymethyl)-7-[[(4-methylphenyl) sulfonyl] oxy]-9H-xanthone 9 (XNT) was administered by daily gavage. The death of retinal ganglion cells (RGC) was evaluated in histological sections, and retinal ACE2, caspase-3, and vascular endothelial growth factor (VEGF) expressions were analyzed by immunohistochemistry. XNT treatment increased ACE2 expression in retinas of hyperglycemic (HG) rats (control: 13.81±2.71 area%; HG: 14.29±4.30 area%; HG+XNT: 26.87±1.86 area%; P<0.05). Importantly, ACE2 activation significantly increased the RCG number in comparison with HG animals (control: 553.5±14.29; HG: 530.8±10.3 cells; HG+XNT: 575.3±16.5 cells; P<0.05). This effect was accompanied by a reduction in the expression of caspase-3 in RGC of the HG+XNT group when compared with untreated HG rats (control: 18.74±1.59; HG: 38.39±3.39 area%; HG+XNT: 27.83±2.80 area%; P<0.05). Treatment with XNT did not alter the VEGF expression in HG animals (P>0.05). Altogether, these findings indicate that activation of ACE2 reduced the death of retinal ganglion cells by apoptosis in HG rats.
Resumo:
Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.
Resumo:
This study aims to explore the effect of microRNA-21 (miR-21) on the proliferation of human degenerated nucleus pulposus (NP) by targeting programmed cell death 4 (PDCD4) tumor suppressor. NP tissues were collected from 20 intervertebral disc degeneration (IDD) patients, and from 5 patients with traumatic spine fracture. MiR-21 expressions were tested. NP cells from IDD patients were collected and divided into blank control group, negative control group (transfected with miR-21 negative sequences), miR-21 inhibitor group (transfected with miR-21 inhibitors), miR-21 mimics group (transfected with miR-21 mimics) and PDCD4 siRNA group (transfected with PDCD4 siRNAs). Cell growth was estimated by Cell Counting Kit-8; PDCD4, MMP-2,MMP-9 mRNA expressions were evaluated by qRT-PCR; PDCD4, c-Jun and p-c-Jun expressions were tested using western blot. In IDD patients, the expressions of miR-21 and PDCD4 mRNA were respectively elevated and decreased (both P<0.05). The miR-21 expressions were positively correlated with Pfirrmann grades, but negatively correlated with PDCD4 mRNA (both P<0.001). In miR-21 inhibitor group, cell growth, MMP-2 and MMP-9 mRNA expressions, and p-c-Jun protein expressions were significantly lower, while PDCD4 mRNA and protein expressions were higher than the other groups (all P<0.05). These expressions in the PDCD4 siRNA and miR-21 mimics groups was inverted compared to that in the miR-21 inhibitor group (all P<0.05). MiR-21 could promote the proliferation of human degenerated NP cells by targeting PDCD4, increasing phosphorylation of c-Jun protein, and activating AP-1-dependent transcription of MMPs, indicating that miR-21 may be a crucial biomarker in the pathogenesis of IDD.
Resumo:
This paper deals with the main evolutions that explain the emergence of new institutional arrangements that characterize the post-fordism. (i) Hence, I will show that the property rights modifications bring forth new forms of competition;(ii) Also, I will make explicit the concrete expressions of this new competition, as well as how it translates itself in a sub-optimum allocation in the framework of the market game; (iii) I will study the modifications of externalities nature produced by technical progress; (iv) Finally, I will analyze the macroeconomic implications in regard to growth mechanisms and to capital nature.