Evaluation of the immune humoral response of Brazilian patients with Rubinstein-Taybi syndrome

Rubinstein-Taybi syndrome (RTS) is a rare developmental disorder characterized by craniofacial dysmorphisms, broad thumbs and toes, mental and growth deficiency, and recurrent respiratory infections. RTS has been associated with CREBBP gene mutations, but EP300 gene mutations have recently been reported in 6 individuals. In the present study, the humoral immune response in 16 RTS patients with recurrent respiratory infections of possible bacterial etiology was evaluated. No significant differences between patients and 16 healthy controls were detected to explain the high susceptibility to respiratory infections: normal or elevated serum immunoglobulin levels, normal salivary IgA levels, and a good antibody response to both polysaccharide and protein antigens were observed. However, most patients presented high serum IgM levels, a high number of total B cell and B subsets, and also high percentiles of apoptosis, suggesting that they could present B dysregulation. The CREBBP/p300 family gene is extremely important for B-cell regulation, and RTS may represent an interesting human model for studying the molecular mechanisms involved in B-cell development.

Novel regulatory SNPs in the promoter region of the TNFRSF18 gene in a Gabonese population

Parasites are accountable for driving diversity within immune gene families. We identified and investigated regulatory single nucleotide polymorphisms (SNPs) in the promoter regions of the tumor necrosis factor receptor superfamily member 18 (TNFRSF18) gene by direct sequencing in a group of male Gabonese individuals exposed to a wide array of parasitic diseases such as malaria, filariasis and schistosomiasis. Two new promoter variants were identified in 40 individuals. Both novel variants were heterozygous and were linked to SNP #rs3753344 (C/T), which has been described. One of the SNP variants (ss2080581728) was close to the general transcription factor site, the TATA box. We further validated these new promoter variants for their allelic gene expression using transient transfection assays. One new promoter variant with two base changes (C/T - ss2080581728/rs3753344) displayed an altered expression of the marker gene. Both novel variants remained less active at the non-induced state in comparison to the major allele. The allele frequencies observed in this study were consistent with data for other African populations. The detection and analysis of these human immune gene polymorphisms contribute to a better understanding of the interaction between host-parasite and expression of Treg activity.

Enhanced anti-tumor effect of a gene gun-delivered DNA vaccine encoding the human papillomavirus type 16 oncoproteins genetically fused to the herpes simplex virus glycoprotein D

Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5) expressing three proteins (E7, E6, and E5) of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id) route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose) induced a strong activation of E7-specific interferon-γ (INF-γ)-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.

Essential regulatory elements for NHE3 gene transcription in renal proximal tubule cells

The objectives of the present study were to identify the cis-elements of the promoter absolutely required for the efficient rat NHE3 gene transcription and to locate positive and negative regulatory elements in the 5’-flanking sequence (5’FS), which might modulate the gene expression in proximal tubules, and to compare this result to those reported for intestinal cell lines. We analyzed the promoter activity of different 5’FS segments of the rat NHE3 gene, in the OKP renal proximal tubule cell line by measuring the activity of the reporter gene luciferase. Because the segment spanning the first 157 bp of 5’FS was the most active it was studied in more detail by sequential deletions, point mutations, and gel shift assays. The essential elements for gene transcription are in the region -85 to -33, where we can identify consensual binding sites for Sp1 and EGR-1, which are relevant to NHE3 gene basal transcription. Although a low level of transcription is still possible when the first 25 bp of the 5’FS are used as promoter, efficient transcription only occurs with 44 bp of 5’FS. There are negative regulatory elements in the segments spanning -1196 to -889 and -467 to -152, and positive enhancers between -889 and -479 bp of 5’FS. Transcription factors in the OKP cell nuclear extract efficiently bound to DNA elements of rat NHE3 promoter as demonstrated by gel shift assays, suggesting a high level of similarity between transcription factors of both species, including Sp1 and EGR-1.

Animal models of prenatal immune challenge and their contribution to the study of schizophrenia: a systematic review

Prenatal immune challenge (PIC) in pregnant rodents produces offspring with abnormalities in behavior, histology, and gene expression that are reminiscent of schizophrenia and autism. Based on this, the goal of this article was to review the main contributions of PIC models, especially the one using the viral-mimetic particle polyriboinosinic-polyribocytidylic acid (poly-I:C), to the understanding of the etiology, biological basis and treatment of schizophrenia. This systematic review consisted of a search of available web databases (PubMed, SciELO, LILACS, PsycINFO, and ISI Web of Knowledge) for original studies published in the last 10 years (May 2001 to October 2011) concerning animal models of PIC, focusing on those using poly-I:C. The results showed that the PIC model with poly-I:C is able to mimic the prodrome and both the positive and negative/cognitive dimensions of schizophrenia, depending on the specific gestation time window of the immune challenge. The model resembles the neurobiology and etiology of schizophrenia and has good predictive value. In conclusion, this model is a robust tool for the identification of novel molecular targets during prenatal life, adolescence and adulthood that might contribute to the development of preventive and/or treatment strategies (targeting specific symptoms, i.e., positive or negative/cognitive) for this devastating mental disorder, also presenting biosafety as compared to viral infection models. One limitation of this model is the incapacity to model the full spectrum of immune responses normally induced by viral exposure.

Association of MICA gene polymorphisms with liver fibrosis in schistosomiasis patients in the Dongting Lake region

Major histocompatibility complex class I chain-related A (MICA) is a highly polymorphic gene located within the MHC class I region of the human genome. Expressed as a cell surface glycoprotein, MICA modulates immune surveillance by binding to its cognate receptor on natural killer cells, NKG2D, and its genetic polymorphisms have been recently associated with susceptibility to some infectious diseases. We determined whether MICA polymorphisms were associated with the high rate of Schistosoma parasitic worm infection or severity of disease outcome in the Dongting Lake region of Hunan Province, China. Polymerase chain reaction-sequence specific priming (PCR-SSP) and sequencing-based typing (SBT) were applied for high-resolution allele typing of schistosomiasis cases (N = 103, age range = 36.2-80.5 years, 64 males and 39 females) and healthy controls (N = 141, age range = 28.6-73.3 years, 73 males and 68 females). Fourteen MICA alleles and five short-tandem repeat (STR) alleles were identified among the two populations. Three (MICA*012:01/02, MICA*017 and MICA*027) showed a higher frequency in healthy controls than in schistosomiasis patients, but the difference was not significantly correlated with susceptibility to S. japonicum infection (Pc > 0.05). In contrast, higher MICA*A5 allele frequency was significantly correlated with advanced liver fibrosis (Pc < 0.05). Furthermore, the distribution profile of MICA alleles in this Hunan Han population was significantly different from those published for Korean, Thai, American-Caucasian, and Afro-American populations (P < 0.01), but similar to other Han populations within China (P > 0.05). This study provides the initial evidence that MICA genetic polymorphisms may underlie the severity of liver fibrosis occurring in schistosomiasis patients from the Dongting Lake region.

Mutations in the HFE gene and sporadic amyotrophic lateral sclerosis risk: a meta-analysis of observational studies

Iron homeostasis dysregulation has been regarded as an important mechanism in neurodegenerative diseases. The H63D and C282Y polymorphisms in theHFE gene may be involved in the development of sporadic amyotrophic lateral sclerosis (ALS) through the disruption of iron homeostasis. However, studies investigating the relationship between ALS and these two polymorphisms have yielded contradictory outcomes. We performed a meta-analysis to assess the roles of the H63D and C282Y polymorphisms of HFEin ALS susceptibility. PubMed, MEDLINE, EMBASE, and Cochrane Library databases were systematically searched to identify relevant studies. Strict selection criteria and exclusion criteria were applied. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. A fixed- or random-effect model was selected, depending on the results of the heterogeneity test. Fourteen studies were included in the meta-analysis (six studies with 1692 cases and 8359 controls for C282Y; 14 studies with 5849 cases and 13,710 controls for H63D). For the C282Y polymorphism, significant associations were observed in the allele model (Y vs C: OR=0.76, 95%CI=0.62-0.92, P=0.005) and the dominant model (YY+CYvs CC: OR=0.75, 95%CI=0.61-0.92, P=0.006). No associations were found for any genetic model for the H63D polymorphism. The C282Y polymorphism in HFE could be a potential protective factor for ALS in Caucasians. However, the H63D polymorphism does not appear to be associated with ALS.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Sequence analysis of the 5′ third of glycoprotein C gene of South American bovine herpesviruses 1 and 5

Bovine herpesviruses 1 (BoHV-1) and 5 (BoHV-5) share high genetic and antigenic similarities, but exhibit marked differences in tissue tropism and neurovirulence. The amino-terminal region of glycoprotein C (gC), which is markedly different in each of the viruses, is involved in virus binding to cellular receptors and in interactions with the immune system. This study investigated the genetic and antigenic differences of the 5′ region of the gC (5′ gC) gene (amino-terminal) of South American BoHV-1 (n=19) and BoHV-5 (n=25) isolates. Sequence alignments of 374 nucleotides (104 amino acids) revealed mean similarity levels of 97.3 and 94.2% among BoHV-1 gC (gC1), respectively, 96.8 and 95.6% among BoHV-5 gC (gC5), and 62 and 53.3% between gC1 and gC5. Differences included the absence of 40 amino acid residues (27 encompassing predicted linear epitopes) scattered throughout 5′ gC1 compared to 5′ gC5. Virus neutralizing assays testing BoHV-1 and BoHV-5 antisera against each isolate revealed a high degree of cross-neutralization between the viruses, yet some isolates were neutralized at very low titers by heterologous sera, and a few BoHV-5 isolates reacted weakly with either sera. The virus neutralization differences observed within the same viral species, and more pronounced between BoHV-1 and BoHV-5, likely reflect sequence differences in neutralizing epitopes. These results demonstrate that the 5′ gC region is well conserved within each viral species but is divergent between BoHV-1 and BoHV-5, likely contributing to their biological and antigenic differences.