119 resultados para genetic polymorphism


Relevância:

60.00% 60.00%

Publicador:

Resumo:

The antibody response to Plasmodium falciparum parasites of naturally infected population is critical to elucidate the role of polymorphic alleles in malaria. Thus, we evaluated the impact of antigenic diversity of repetitive and family dimorphic domains of the merozoite surface protein 2 (MSP-2) on immune response of 96 individuals living in Peixoto de Azevedo (MT-Brazil), by ELISA using recombinant MSP-2 proteins. The majority of these individuals were carrying FC27-type infections. IgG antibody responses were predominantly directed to FC27 parasites and were correlated to the extension of polymorphism presented by each MSP-2 region. This finding demonstrated the impact of the genetic polymorphism on antibody response and therefore, its importance on malaria vaccine efficacy.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The present study investigated the prevalence of mutations in the -550 (H/L) and -221 (X/Y) mannose-binding lectin (MBL) gene promoter regions and their impact on infection by human immunodeficiency virus 1 (HIV-1) in a population of 128 HIV-1 seropositive and 97 seronegative patients. The allele identification was performed through the sequence-specific primer polymerase chain reaction method, using primer sequences specific to each polymorphism. The evolution of the infection was evaluated through CD4+ T-lymphocyte counts and plasma viral load. The allele and haplotype frequencies among HIV-1-infected patients and seronegative healthy control patients did not show significant differences. CD4+ T-lymphocyte counts showed lower levels among seropositive patients carrying haplotypes LY, LX and HX, as compared to those carrying the HY haplotype. Mean plasma viral load was higher among seropositive patients with haplotypes LY, LX and HX than among those carrying the HY haplotype. When promoter and exon 1 mutations were matched, it was possible to identify a significantly higher viral load among HIV-1 infected individuals carrying haplotypes correlated to low serum levels of MBL. The current study shows that haplotypes related to medium and low MBL serum levels might directly influence the evolution of viral progression in patients. Therefore, it is suggested that the identification of haplotypes within the promoter region of the MBL gene among HIV-1 infected persons should be further evaluated as a prognostic tool for AIDS progression.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

This is the first study describing the genetic polymorphism of Mycobacterium tuberculosis strains in the Indian Ocean Region. Using IS6110 RFLP analysis, 475 M. tuberculosis isolates from Madagascar, Comoros, Mauritius, Mozambique and La Reunion were compared. Of the 332 IS6110 profiles found, 43 were shared by clusters containing 2-65 strains. Six clusters were common to at least two countries. Of 52 families of strains with similar IS6110 profiles, 10 were common to at least two countries. Interestingly, another characteristic was the frequency (16.8%) of IS6110 single-copy strains. These strains could be distinguished using the DR marker. This preliminary evaluation suggests genetic similarity between the strains of the Indian Ocean Region. However, additional markers would be useful for epidemiological studies and to assess the ancient transmission of strains between countries of this region.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The contribution of genetic factors to the development of obesity has been widely recognized, but the identity of the genes involved has not yet been fully clarified. Variation in genes involved in adipocyte differentiation and energy metabolism is expected to have a role in the etiology of obesity. We assessed the potential association of a polymorphism in one candidate gene, peroxisome proliferator-activated receptor-gamma (PPARGg), involved in these pathways and obesity-related phenotypes in 335 Brazilians of European descent. All individuals included in the sample were adults. Pregnant women, as well as those individuals with secondary hyperlipidemia due to renal, liver or thyroid disease, and diabetes, were not invited to participate in the study; all other individuals were included. The gene variant PPARG Pro12Ala was studied by a PCR-based method and the association between this genetic polymorphism and obesity-related phenotypes was evaluated by analysis of covariance. Variant allele frequency was PPARG Ala12 = 0.09 which is in the same range as described for European and European-derived populations. No statistically significant differences were observed for mean total cholesterol, LDL cholesterol, HDL cholesterol, or triglyceride levels among PPARG genotypes in either gender. In the male sample, an association between the PPARG Pro12Ala variant and body mass index was detected, with male carriers of the Ala variant presenting a higher mean body mass index than wild-type homozygotes (28.3 vs 26.2 kg/m², P = 0.037). No effect of this polymorphism was detected in women. This finding suggests that the PPARG gene has a gender-specific effect and contributes to the susceptibility to obesity in this population.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Bovine coronavirus (BCoV) causes severe diarrhea in newborn calves, is associated with winter dysentery in adult cattle and respiratory infections in calves and feedlot cattle. The BCoV S protein plays a fundamental role in viral attachment and entry into the host cell, and is cleaved into two subunits termed S1 (amino terminal) and S2 (carboxy terminal). The present study describes a strategy for the sequencing of the BCoV S1 gene directly from fecal diarrheic specimens that were previously identified as BCoV positive by RT-PCR assay for N gene detection. A consensus sequence of 2681 nucleotides was obtained through direct sequencing of seven overlapping PCR fragments of the S gene. The samples did not undergo cell culture passage prior to PCR amplification and sequencing. The structural analysis was based on the genomic differences between Brazilian strains and other known BCoV from different geographical regions. The phylogenetic analysis of the entire S1 gene showed that the BCoV Brazilian strains were more distant from the Mebus strain (97.8% identity for nucleotides and 96.8% identity for amino acids) and more similar to the BCoV-ENT strain (98.7% for nucleotides and 98.7% for amino acids). Based on the phylogenetic analysis of the hypervariable region of the S1 subunit, these strains clustered with the American (BCoV-ENT, 182NS) and Canadian (BCQ20, BCQ2070, BCQ9, BCQ571, BCQ1523) calf diarrhea and the Canadian winter dysentery (BCQ7373, BCQ2590) strains, but clustered on a separate branch of the Korean and respiratory BCoV strains. The BCoV strains of the present study were not clustered in the same branch of previously published Brazilian strains (AY606193, AY606194). These data agree with the genealogical construction and suggest that at least two different BCoV strains are circulating in Brazil.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

In the present study we report the results of an analysis, based on ribotyping of Corynebacterium diphtheriae intermedius strains isolated from a 9 years old child with clinical diphtheria and his 5 contacts. Quantitative analysis of RFLPs of rRNA was used to determine relatedness of these 7 C.diphtheriae strains providing support data in the diphtheria epidemiology. We have also tested those strains for toxigenicity in vitro by using the Elek's gel diffusion method and in vivo by using cell culture method on cultured monkey kidney cell (VERO cells). The hybridization results revealed that the 5 C.diphtheriae strains isolated from contacts and one isolated from the clinical case (nose case strain) had identical RFLP patterns with all 4 restriction endonucleases used, ribotype B. The genetic distance from this ribotype and ribotype A (throat case strain), that we initially assumed to be responsible for the illness of the patient, was of 0.450 showing poor genetic correlation among these two ribotypes. We found no significant differences concerned to the toxin production by using the cell culture method. In conclusion, the use of RFLPs of rRNA gene was successful in detecting minor differences in closely related toxigenic C.diphtheriae intermedius strains and providing information about genetic relationships among them.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Most of the Brazilian HIV-1 samples have been characterized based on the structural genes (env, gag and pol) and no data concerning the variability of the accessory genes such as nef have been available so far. Considering the role of the nef on virus biology and the inclusion of this region in some HIV/AIDS vaccine products under testing, the purpose of this study was to document the genetic diversity of the nef gene in third-four HIV-1 Brazilian samples previously subtyped based on the env C2-V3 region. Although only few non-subtype B samples have already been analyzed so far, the cytotoxic Tlymphocyte epitopes encoded in this region were relatively conserved among the subtypes, with some amino acid signatures mainly in the subtype C samples. Considering the increasing of the non-B HIV-1 subtypes worldwide, in special the subtype C, more data should be generated concerning the genetic and antigenic variability of these subtypes, as well as the study of the impact of such polymorphism in HIV/AIDS vaccine design and testing.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Simple double repetitive element polymerase chain reaction (MaDRE-PCR) and Pvu II-IS1245 restriction fragment length polymorphism (RFLP) typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Genetic structure of populations of Pissodes castaneus (De Geer) (Coleoptera, Curculionidae) using amplified fragment length polymorphism. The objective of this study was to determine the genetic structure of populations of Pissodes castaneus from different areas and on different species of Pinus using the PCR-AFLP technique. Twenty samples were analyzed, representing 19 populations from Brazil and one from Florence, Italy, which is the region of origin of P. castaneus. The four combinations of primers generated a total of 367 fragments of DNA, and 100% of polymorphic loci, indicating high degree of molecular polymorphism. The dendrogram did not reveal trends for grouping the populations in relation to origin. The low genetic similarity (0.11 between the most distant groups) and genetic distances of 0.13 and 0.44 for 10 out of the 20 samples may indicate several founding events or multiple introductions of heterogeneous strains into Brazil. The allelic fixation index (Fst) was 0.3851, considered high, and the number of migrants (Nm) was 0.3991, indicating low gene flow among populations. The highest genetic distances were between the population from Irani, SC and Cambará do Sul, RS and Bituruna, PR, indicating an independent founding event or a particular allelic fixation in the former location. The high genetic diversity among populations points out that the populations are genetically heterogeneous with a diverse gene pool in the surveyed areas, what makes them to respond differently to control measures.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Recent animal studies have indicated that overexpression of the elongation of long-chain fatty acids family member 6 (Elovl6) gene can cause insulin resistance and β-cell dysfunction. These are the major factors involved in the development of type 2 diabetes mellitus (T2DM). To identify the relationship between single nucleotide polymorphisms (SNP) ofELOVL6 and T2DM pathogenesis, we conducted a case-control study of 610 Han Chinese individuals (328 newly diagnosed T2DM and 282 healthy subjects). Insulin resistance and islet first-phase secretion function were evaluated by assessment of insulin resistance in a homeostasis model (HOMA-IR) and an arginine stimulation test. Three SNPs of the ELOVL6 gene were genotyped with polymerase chain reaction-restriction fragment length polymorphism, with DNA sequencing used to confirm the results. Only genotypes TT and CT of the ELOVL6 SNP rs12504538 were detected in the samples. Genotype CC was not observed. The T2DM group had a higher frequency of the C allele and the CT genotype than the control group. Subjects with the CT genotype had higher HOMA-IR values than those with the TT genotype. In addition, no statistical significance was observed between the genotype and allele frequencies of the control and T2DM groups for SNPs rs17041272 and rs6824447. The study indicated that the ELOVL6 gene polymorphism rs12504538 is associated with an increased risk of T2DM, because it causes an increase in insulin resistance.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Genetic diversity in a collection of 64 sugar apple accessions collected from different municipalities in northern Minas Gerais was assessed by RAPD analysis. Using 20 selected RAPD primers 167 fragments were generated, of which 48 were polymorphic (28.7%) producing an average of 2.4 polymorphic fragments per primer. Low percentage of polymorphism (< 29%) was observed by using the set of primers indicating low level of genetic variation among the 64 accessions evaluated. Genetic relationships were estimated using Jaccard's coefficient of similarity. Accessions from different municipalities clustered together indicating no correlation between molecular grouping and geographical origin. The dendrogram revealed five clusters. The first cluster grouped C19 and G29 accessions collected from the municipalities of Verdelândia and Monte Azul, respectively. The second cluster grouped G16 and B11 accessions collected from the municipalities of Monte Azul and Coração de Jesus, respectively. The remaining accessions were grouped in three clusters, with 8, 15 and 37 accessions, respectively. In summary, RAPD showed a low percentage of polymorphism in the germplasm collection.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Individual cancer susceptibility seems to be related to factors such as changes in oncogenes and tumor suppressor genes expression, and differences in the action of metabolic enzymes and DNA repair regulated by specific genes. Epidemiological studies on genetic polymorphisms of human xenobiotics metabolizing enzymes and cancer have revealed low relative risks. Research considering genetic polymorphisms prevalence jointly with environmental exposures could be relevant for a better understanding of cancer etiology and the mechanisms of carcinogenesis and also for new insights on cancer prognosis. This study reviews the approaches of molecular epidemiology in cancer research, stressing case-control and cohort designs involving genetic polymorphisms, and factors that could introduce bias and confounding in these studies. Similarly to classical epidemiological research, genetic polymorphisms requires considering aspects of precision and accuracy in the study design.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The aim of the present study was to determine biological characteristics such as expression of fimbriae, Congo red binding, production of hemolysin and aerobactin, adhesion to HeLa and uroepithelial cells and invasion of HeLa cells by Escherichia coli isolates obtained from patients showing clinical signs of urinary tract infection (UTI). Also, the presence of genes (apa, afa, spa) for fimbria expression and cytotoxic necrotizing factors (CNF1, CNF2) was assayed using specific primers in PCR. The data obtained were compared with the clonal relationships obtained by analysis of multilocus enzyme electrophoresis (MLEE), restriction fragment length polymorphism (RFLP) of the rDNA (ribotyping) and enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR). All isolates but one presented a combination of at least two of the characteristics studied, a fact suggesting the presence of pathogenicity islands (PAIs). Diffuse adherence type to HeLa cells was observed to occur in most of the strains, but adhesion to uroepithelial cells seems to be a more reliable test to verify pathogenicity. Although four strains seemed to be able to invade HeLa cells when assayed by light microscopy, electron microscopy studies demonstrated that these strains were not invasive. MLEE, RFLP and ERIC-PCR were able to group the isolates differently into main clusters that were not correlated with the presence of pathogenic traits.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Seroprevalence of HCMV in Costa Rica is greater than 95% in adults; primary infections occur early in life and is the most frequent congenital infection in newborns. The objectives of this study were to determine the genetic variability and genotypes of HCMV gB gene in Costa Rica. Samples were collected from alcoholics, pregnant women, blood donors, AIDS patients, hematology-oncology (HO) children and HCMV isolates from neonates with cytomegalic inclusion disease. A semi-nested PCR system was used to obtain a product of 293-296 bp of the gB gene to be analyzed by Single Stranded Conformational Polymorphism (SSCP) and sequencing to determine the genetic polymorphic pattern and genotypes, respectively. AIDS patients showed the highest polymorphic diversity with 14 different patterns while fifty-six percent of HO children samples showed the same polymorphic pattern, suggesting in this group a possible nosocomial infection. In neonates three genotypes (gB1, gB2 and gB3), were determined while AIDS patients and blood donors only showed one (gB2). Of all samples analyzed only genotypes gB1, 2 and 3 were determined, genotype gB2 was the most frequent (73%) and mixed infections were not detected. The results of the study indicate that SSCP could be an important tool to detect HCMV intra-hospital infections and suggests a need to include additional study populations to better determine the genotype diversity and prevalence.