Identification of anaerobic threshold using heart rate response during dynamic exercise

The objective of the present study was to characterize the heart rate (HR) patterns of healthy males using the autoregressive integrated moving average (ARIMA) model over a power range assumed to correspond to the anaerobic threshold (AT) during discontinuous dynamic exercise tests (DDET). Nine young (22.3 ± 1.57 years) and 9 middle-aged (MA) volunteers (43.2 ± 3.53 years) performed three DDET on a cycle ergometer. Protocol I: DDET in steps with progressive power increases of 10 W; protocol II: DDET using the same power values as protocol 1, but applied randomly; protocol III: continuous dynamic exercise protocol with ventilatory and metabolic measurements (10 W/min ramp power), for the measurement of ventilatory AT. HR was recorded and stored beat-to-beat during DDET, and analyzed using the ARIMA (protocols I and II). The DDET experiments showed that the median physical exercise workloads at which AT occurred were similar for protocols I and II, i.e., AT occurred between 75 W (116 bpm) and 85 W (116 bpm) for the young group and between 60 W (96 bpm) and 75 W (107 bpm) for group MA in protocols I and II, respectively; in two MA volunteers the ventilatory AT occurred at 90 W (108 bpm) and 95 W (111 bpm). This corresponded to the same power values of the positive trend in HR responses. The change in HR response using ARIMA models at submaximal dynamic exercise powers proved to be a promising approach for detecting AT in normal volunteers.

Effect of high hydrostatic pressure on the barrier properties of polyamide-6 films

Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.

Beneficial effect of recombinant human growth hormone on the intestinal mucosa barrier of septic rats

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Tumor necrosis factor alpha increases epithelial barrier permeability by disrupting tight junctions in Caco-2 cells

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Hemodynamic mechanisms of the attenuated blood pressure response to mental stress after a single bout of maximal dynamic exercise in healthy subjects

To determine the hemodynamic mechanisms responsible for the attenuated blood pressure response to mental stress after exercise, 26 healthy sedentary individuals (age 29 ± 8 years) underwent the Stroop color-word test before and 60 min after a bout of maximal dynamic exercise on a treadmill. A subgroup (N = 11) underwent a time-control experiment without exercise. Blood pressure was continuously and noninvasively recorded by infrared finger photoplethysmography. Stroke volume was derived from pressure signals, and cardiac output and peripheral vascular resistance were calculated. Perceived mental stress scores were comparable between mental stress tests both in the exercise (P = 0.96) and control (P = 0.24) experiments. After exercise, the blood pressure response to mental stress was attenuated (pre: 10 ± 13 vs post: 6 ± 7 mmHg; P < 0.01) along with lower values of systolic blood pressure (pre: 129 ± 3 vs post: 125 ± 3 mmHg; P < 0.05), stroke volume (pre: 89.4 ± 3.5 vs post: 76.8 ± 3.8 mL; P < 0.05), and cardiac output (pre: 7.00 ± 0.30 vs post: 6.51 ± 0.36 L/min; P < 0.05). Except for heart rate, the hemodynamic responses and the mean values during the two mental stress tests in the control experiment were similar (P > 0.05). In conclusion, a single bout of maximal dynamic exercise attenuates the blood pressure response to mental stress in healthy subjects, along with lower stroke volume and cardiac output, denoting an acute modulatory action of exercise on the central hemodynamic response to mental stress.

Dynamic expression of desmin, α-SMA and TGF-β1 during hepatic fibrogenesis induced by selective bile duct ligation in young rats

We previously described a selective bile duct ligation model to elucidate the process of hepatic fibrogenesis in children with biliary atresia or intrahepatic biliary stenosis. Using this model, we identified changes in the expression of alpha smooth muscle actin (α-SMA) both in the obstructed parenchyma and in the hepatic parenchyma adjacent to the obstruction. However, the expression profiles of desmin and TGF-β1, molecules known to be involved in hepatic fibrogenesis, were unchanged when analyzed by semiquantitative polymerase chain reaction (RT-PCR). Thus, the molecular mechanisms involved in the modulation of liver fibrosis in this experimental model are not fully understood. This study aimed to evaluate the molecular changes in an experimental model of selective bile duct ligation and to compare the gene expression changes observed in RT-PCR and in real-time quantitative PCR (qRT‐PCR). Twenty-eight Wistar rats of both sexes and weaning age (21-23 days old) were used. The rats were separated into groups that were assessed 7 or 60 days after selective biliary duct ligation. The expression of desmin, α-SMA and TGF-β1 was examined in tissue from hepatic parenchyma with biliary obstruction (BO) and in hepatic parenchyma without biliary obstruction (WBO), using RT-PCR and qRT‐PCR. The results obtained in this study using these two methods were significantly different. The BO parenchyma had a more severe fibrogenic reaction, with increased α-SMA and TGF-β1 expression after 7 days. The WBO parenchyma presented a later, fibrotic response, with increased desmin expression 7 days after surgery and increased α-SMA 60 days after surgery. The qRT‐PCR technique was more sensitive to expression changes than the semiquantitative method.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Evaluation of noni (Morinda citrifolia) volatile profile by dynamic headspace and gas chromatography-mass spectrometry

Noni is a fruit that has interested the scientific community due to its medicinal and functional activities. Different products that contain noni are already in the market, but their consumption could be impaired by their distinctive unpleasant aroma and flavor. The aim of this work was to evaluate the noni pulp volatile profile by dynamic headspace and gas chromatography-mass spectrometry. Thirty seven volatile compounds were detected, mainly alcohols (63.3%), esters (26.9%), cetones (7.4%), and acids (1.2%).

Dynamic nature of human rights: Rawls's critique of moral universalism

Human rights do not represent an absolute truth. Otherwise, they would represent ideology, which is contradictory to the basic idea of human rights itself. Consequently, there is a need for redefinition of the main presuppositions of modern conception of human rights represented in the Universal Declaration of Human Rights. This paper argues that Rawls's conception of human rights is significant for the refiguration of human rights. It represents the path towards postmodern idea of human rights and the recognition of difference.