In vitro Comparison of Disk Diffusion and Agar Dilution Antibiotic Susceptibility Test Methods for Neisseria gonorrhoeae

At present, most Neisseria gonorrhoeae testing is done with ß-lactamase and agar dilution tests with common therapeutic agents. Generally, in bacteriological diagnosis laboratories in Argentina, study of antibiotic susceptibility of N.gonorrhoeae is based on ß-lactamase determination and agar dilution method with common therapeutic agents. The National Committee for Clinical Laboratory Standards (NCCLS) has recently described a disk diffusion test that produces results comparable to the reference agar dilution method for antibiotic susceptibility of N.gonorrhoeae, using a dispersion diagram for analyzing the correlation between both techniques. We obtained 57 gonococcal isolates from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina. Antibiotic susceptibility tests using agar dilution and disk diffusion techniques were compared. The established NCCLS interpretive criteria for both susceptibility methods appeared to be applicable to domestic gonococcal strains. The correlation between the MIC's and the zones of inhibition was studied for penicillin, ampicillin, cefoxitin, spectinomycin, cefotaxime, cephaloridine, cephalexin, tetracycline, norfloxacin and kanamycin. Dispersion diagrams showed a high correlation between both methods.

Antimalarial drug susceptibility testing of Plasmodium falciparum in Brazil using a radioisotope method

From March 1996 to August 1997, a study was carried out in a malaria endemic area of the Brazilian Amazon region. In vivo sensitivity evaluation to antimalarial drugs was performed in 129 patients. Blood samples (0.5 ml) were drawn from each patient and cryopreserved to proceed to in vitro studies. In vitro sensitivity evaluation performed using a radioisotope method was carried out with the cryopreserved samples from September to December 1997. Thirty-one samples were tested for chloroquine, mefloquine, halofantrine, quinine, arteether and atovaquone. Resistance was evidenced in 96.6% (29/30) of the samples tested for chloroquine, 3.3% (1/30) for quinine, none (0/30) for mefloquine and none for halofantrine (0/30). Overall low sensitivity was evidenced in 10% of the samples tested for quinine, 22.5% tested for halofantrine and in 20% tested for mefloquine. Means of IC 50 values were 132.2 (SD: 46.5) ng/ml for chloroquine, 130.6 (SD: 49.6) ng/ml for quinine, 3.4 (SD: 1.3) ng/ml for mefloquine, 0.7 (SD: 0.3) ng/ml for halofantrine, 1 (SD: 0.6) ng/ml for arteether and 0.4 (SD: 0.2) ng/ml for atovaquone. Means of chloroquine IC 50 of the tested samples were comparable to that of the chloroquine-resistant strain W2 (137.57 ng/ml) and nearly nine times higher than that of the chloroquine-sensitive strain D6 (15.09 ng/ml). Means of quinine IC 50 of the tested samples were 1.7 times higher than that of the low sensitivity strain W2 (74.84 ng/ml) and nearly five times higher than that of the quinine-sensitive strain D6 (27.53 ng/ml). These results disclose in vitro high resistance levels to chloroquine, low sensitivity to quinine and evidence of decreasing sensitivity to mefloquine and halofantrine in the area under evaluation.

Diagnostic performance characteristics of rapid dipstick test for Plasmodium vivax malaria

We compared the diagnostic performance characteristics of newly developed method, the rapid dipstick test, which provides colorimetric determination by developing antibody to the lactate dehydrogenase enzyme of parasites, with conventional standard thick-blood film examination. For the rapid test, OptiMAL commercial kits were used. The results were also evaluated with clinical findings from patients. The parasites were determined by microscopic examination of thick-blood films from 81 patients with vivax malaria from southeastern Anatolia, Turkey. The OptiMAL test results were found to be negative in five patients who were diagnosed clinically and through thick-film testing as having vivax malaria. There was no false positivity observed with the OptiMAL test. We concluded that this rapid malaria test has a lower level of sensitivity than the classical thick-blood-film test for malaria, but that these methods have equal specificity.

Evaluation of rapid alternative methods for drug susceptibility testing in clinical isolates of Mycobacterium tuberculosis

A study was carried out to compare the performance of a commercial method (MGIT) and four inexpensive drug susceptibility methods: nitrate reductase assay (NRA), microscopic observation drug susceptibility (MODS) assay, MTT test, and broth microdilution method (BMM). A total of 64 clinical isolates of Mycobacterium tuberculosis were studied. The Lowenstein-Jensen proportion method (PM) was used as gold standard. MGIT, NRA, MODS, and MTT results were available on an average of less than 10 days, whereas BMM results could be reported in about 20 days. Most of the evaluated tests showed excellent performance for isoniazid and rifampicin, with sensitivity and specificity values > 90%. With most of the assays, sensitivity for ethambutol was low (62-87%) whereas for streptomycin, sensitivity values ranged from 84 to 100%; NRA-discrepancies were associated with cultures with a low proportion of EMB-resistant organisms while most discrepancies with quantitative tests (MMT and BMM) were seen with isolates whose minimal inhibitory concentrations fell close the cutoff. MGIT is reliable but still expensive. NRA is the most inexpensive and easiest method to perform without changing the organization of the routine PM laboratory performance. While MODS, MTT, and BMM, have the disadvantage from the point of view of biosafety, they offer the possibility of detecting partial resistant strains. This study shows a very good level of agreement of the four low-cost methods compared to the PM for rapid detection of isoniazid, rifampicin and streptomycin resistance (Kappa values > 0.8); more standardization is needed for ethambutol.

Fast test for assessing the susceptibility of Mycobacterium tuberculosis to isoniazid and rifampin by real-time PCR

Mycobacterium tuberculosis is the bacterium that causes tuberculosis (TB), a leading cause of death from infectious disease worldwide. Rapid diagnosis of resistant strains is important for the control of TB. Real-time polymerase chain reaction (RT-PCR) assays may detect all of the mutations that occur in the M. tuberculosis 81-bp core region of the rpoB gene, which is responsible for resistance to rifampin (RIF) and codon 315 of the katG gene and the inhA ribosomal binding site, which are responsible for isoniazid (INH). The goal of this study was to assess the performance of RT-PCR compared to traditional culture-based methods for determining the drug susceptibility of M. tuberculosis. BACTEC TM MGIT TM 960 was used as the gold standard method for phenotypic drug susceptibility testing. Susceptibilities to INH and RIF were also determined by genotyping of katG, inhA and rpoB genes. RT-PCR based on molecular beacons probes was used to detect specific point mutations associated with resistance. The sensitivities of RT-PCR in detecting INH resistance using katG and inhA targets individually were 55% and 25%, respectively and 73% when combined. The sensitivity of the RT-PCR assay in detecting RIF resistance was 99%. The median time to complete the RT-PCR assay was three-four hours. The specificities for tests were both 100%. Our results confirm that RT-PCR can detect INH and RIF resistance in less than four hours with high sensitivity.

Serial QuantiFERON-TB Gold In-Tube assay and tuberculin skin test to diagnose latent tuberculosis in household Mexican contacts: conversion and reversion rates and associated factors using conventional and borderline zone definitions

A cohort of 123 adult contacts was followed for 18‐24 months (86 completed the follow-up) to compare conversion and reversion rates based on two serial measures of QuantiFERON (QFT) and tuberculin skin test (TST) (PPD from TUBERSOL, Aventis Pasteur, Canada) for diagnosing latent tuberculosis (TB) in household contacts of TB patients using conventional (C) and borderline zone (BZ) definitions. Questionnaires were used to obtain information regarding TB exposure, TB risk factors and socio-demographic data. QFT (IU/mL) conversion was defined as <0.35 to ≥0.35 (C) or <0.35 to >0.70 (BZ) and reversion was defined as ≥0.35 to <0.35 (C) or ≥0.35 to <0.20 (BZ); TST (mm) conversion was defined as <5 to ≥5 (C) or <5 to >10 (BZ) and reversion was defined as ≥5 to <5 (C). The QFT conversion and reversion rates were 10.5% and 7% with C and 8.1% and 4.7% with the BZ definitions, respectively. The TST rates were higher compared with QFT, especially with the C definitions (conversion 23.3%, reversion 9.3%). The QFT conversion and reversion rates were higher for TST ≥5; for TST, both rates were lower for QFT <0.35. No risk factors were associated with the probability of converting or reverting. The inconsistency and apparent randomness of serial testing is confusing and adds to the limitations of these tests and definitions to follow-up close TB contacts.

Sensitivity and specificity of parallel or serial serological testing for detection of canine Leishmania infection

In Brazil, human and canine visceral leishmaniasis (CVL) caused byLeishmania infantum has undergone urbanisation since 1980, constituting a public health problem, and serological tests are tools of choice for identifying infected dogs. Until recently, the Brazilian zoonoses control program recommended enzyme-linked immunosorbent assays (ELISA) and indirect immunofluorescence assays (IFA) as the screening and confirmatory methods, respectively, for the detection of canine infection. The purpose of this study was to estimate the accuracy of ELISA and IFA in parallel or serial combinations. The reference standard comprised the results of direct visualisation of parasites in histological sections, immunohistochemical test, or isolation of the parasite in culture. Samples from 98 cases and 1,327 noncases were included. Individually, both tests presented sensitivity of 91.8% and 90.8%, and specificity of 83.4 and 53.4%, for the ELISA and IFA, respectively. When tests were used in parallel combination, sensitivity attained 99.2%, while specificity dropped to 44.8%. When used in serial combination (ELISA followed by IFA), decreased sensitivity (83.3%) and increased specificity (92.5%) were observed. Serial testing approach improved specificity with moderate loss in sensitivity. This strategy could partially fulfill the needs of public health and dog owners for a more accurate diagnosis of CVL.

Violence against adolescents: an analysis based on the categories gender and generation

Exploratory and descriptive study based on quantitative and qualitative methods that analyze the phenomenon of violence against adolescents based on gender and generational categories. The data source was reports of violence from the Curitiba Protection Network from 2010 to 2012 and semi-structured interviews with 16 sheltered adolescents. Quantitative data were analyzed using SPSS software version 20.0 and the qualitative data were subjected to content analysis. The adolescents were victims of violence in the household and outside of the family environment, as victims or viewers of violence. The violence was experienced at home, mostly toward girls, with marked overtones of gender violence. More than indicating the magnitude of the issue, this study can give information to help qualify the assistance given to victimized people and address how to face this issue.

Public-domain software for root image analysis

In the search for high efficiency in root studies, computational systems have been developed to analyze digital images. ImageJ and Safira are public-domain systems that may be used for image analysis of washed roots. However, differences in root properties measured using ImageJ and Safira are supposed. This study compared values of root length and surface area obtained with public-domain systems with values obtained by a reference method. Root samples were collected in a banana plantation in an area of a shallower Typic Carbonatic Haplic Cambisol (CXk), and an area of a deeper Typic Haplic Ta Eutrophic Cambisol (CXve), at six depths in five replications. Root images were digitized and the systems ImageJ and Safira used to determine root length and surface area. The line-intersect method modified by Tennant was used as reference; values of root length and surface area measured with the different systems were analyzed by Pearson's correlation coefficient and compared by the confidence interval and t-test. Both systems ImageJ and Safira had positive correlation coefficients with the reference method for root length and surface area data in CXk and CXve. The correlation coefficient ranged from 0.54 to 0.80, with lowest value observed for ImageJ in the measurement of surface area of roots sampled in CXve. The IC (95 %) revealed that root length measurements with Safira did not differ from that with the reference method in CXk (-77.3 to 244.0 mm). Regarding surface area measurements, Safira did not differ from the reference method for samples collected in CXk (-530.6 to 565.8 mm²) as well as in CXve (-4231 to 612.1 mm²). However, measurements with ImageJ were different from those obtained by the reference method, underestimating length and surface area in samples collected in CXk and CXve. Both ImageJ and Safira allow an identification of increases or decreases in root length and surface area. However, Safira results for root length and surface area are closer to the results obtained with the reference method.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Electrical conductivity testing of corn seeds as influenced by temperature and period of storage

The objective of this work was to evaluate the effects of temperature (10, 20, 30, 20/10 and 30/10ºC) and period of storage on electrical conductivity (EC) in four seed lots of corn (Zea mays L.), as well as the mineral composition of the soaking solution. EC test determines indirectly the integrity of seed membrane systems, and is used for the assessment of seed vigor, because this test detects the seed deterioration process since its early phase. The research comprised determinations of water content, germination, accelerated aging (AA), cold (CT) and EC vigor tests, and determinations of Ca2+, Mg2+ and K+ release to the solution, after seed soaking of four corn seed lots. The evaluations were performed each four months during a period of 16 months. For statistical analysis, a completely randomized split plot design was used with eight replications. Except for seed lots stored at 10ºC, all vigor evaluations revealed a decline in vigor, but AA and CT showed more sensitiveness to declines of seed physiological quality than EC. Potassium was the main leached ion regardless of the storage temperature.

Reproducing the organic matter model of anthropogenic dark earth of Amazonia and testing the ecotoxicity of functionalized charcoal compounds

The objective of this work was to obtain organic compounds similar to the ones found in the organic matter of anthropogenic dark earth of Amazonia (ADE) using a chemical functionalization procedure on activated charcoal, as well as to determine their ecotoxicity. Based on the study of the organic matter from ADE, an organic model was proposed and an attempt to reproduce it was described. Activated charcoal was oxidized with the use of sodium hypochlorite at different concentrations. Nuclear magnetic resonance was performed to verify if the spectra of the obtained products were similar to the ones of humic acids from ADE. The similarity between spectra indicated that the obtained products were polycondensed aromatic structures with carboxyl groups: a soil amendment that can contribute to soil fertility and to its sustainable use. An ecotoxicological test with Daphnia similis was performed on the more soluble fraction (fulvic acids) of the produced soil amendment. Aryl chloride was formed during the synthesis of the organic compounds from activated charcoal functionalization and partially removed through a purification process. However, it is probable that some aryl chloride remained in the final product, since the ecotoxicological test indicated that the chemical functionalized soil amendment is moderately toxic.

Dose calibrator linearity test: 99mTc versus 18F radioisotopes

Objective: The present study was aimed at evaluating the viability of replacing 18F with 99mTc in dose calibrator linearity testing. Materials and Methods: The test was performed with sources of 99mTc (62 GBq) and 18F (12 GBq) whose activities were measured up to values lower than 1 MBq. Ratios and deviations between experimental and theoretical 99mTc and 18F sources activities were calculated and subsequently compared. Results: Mean deviations between experimental and theoretical 99mTc and 18F sources activities were 0.56 (± 1.79)% and 0.92 (± 1.19)%, respectively. The mean ratio between activities indicated by the device for the 99mTc source as measured with the equipment pre-calibrated to measure 99mTc and 18F was 3.42 (± 0.06), and for the 18F source this ratio was 3.39 (± 0.05), values considered constant over the measurement time. Conclusion: The results of the linearity test using 99mTc were compatible with those obtained with the 18F source, indicating the viability of utilizing both radioisotopes in dose calibrator linearity testing. Such information in association with the high potential of radiation exposure and costs involved in 18F acquisition suggest 99mTc as the element of choice to perform dose calibrator linearity tests in centers that use 18F, without any detriment to the procedure as well as to the quality of the nuclear medicine service.

Development of new dissolution test and HPLC-RP method for anti-parasitic ornidazole coated tablets

This work aimed the development and validation of a new dissolution test for ornidazole coated tablets. The dissolution conditions were determined after testing Sink conditions, dissolution medium, apparatus, stirring speed, 24 h stability and medium filtration influence. The best conditions were paddle at a stirring speed of 75 rpm and 900 mL of 0.1 M HCl. A new HPLC quantification method was developed and validated. The dissolution test and quantification method showed to be adequate for their purposes and could be applied for quality control of ornidazole coated tablets, since there is no official monograph.

Ressonância: desenvolvimento, utilização e avaliação de um software educacional

Resonance is a useful concept that shows how electrons are shared between two or more atoms and allows a prediction of the chemical reactivity and relative stability of reagents, intermediates, and products. An educational software that enables interactive exploration of the concepts related to resonance and thereby facilitates its understanding was developed. The software was field-tested, and an evaluation questionnaire concerning the software as an educational tool was answered by the students and professors involved in the test. The results led to the conclusion that the developed computer application can be characterized as an auxiliary tool that assists teachers in their lectures and students in their learning process.