Genetic grouping of avian infectious bronchitis virus isolated in Brazil based on RT-PCR/RFLP analysis of the S1 gene

Twelve Brazilian isolates and one reference vaccine strain of avian infectious bronchitis virus (IBV) were propagated in embryonating chicken eggs. The entire S1 glycoprotein gene of these viruses was analysed by reverse-transcriptase-polymerase chain reaction and restriction fragment length polymorphism (RT-PCR-RFLP), using the restriction enzymes HaeIII, XcmI and BstyI. The RFLP patterns led to the classification of these isolates into five distinct genotypes: A, B, C, D and Massachusetts. Five of twelve isolates were grouped in Massachusetts genotype and the remaining seven viruses were classified into four distinct genotypes: A (2), B (2), C (2) or D (1). Such genotyping classification agreed with previous immunological analysis for most of these viruses, highlighting the occurrence of a relevant variability among the IBV strains that are circulating in Brazilian commercial poultry flocks.

Rapid detection of bovine coronavirus by a semi-nested RT-PCR

Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.

Perfil hematológico de equinos submetidos à prova de Team Penning

As variações nos parâmetros hematológicos são utilizadas com intuito de avaliar o grau de treinamento ou estado clínico do animal. A avaliação hematológica de eqüinos em repouso tem sido objeto de estudo, a fim de estabelecer uma relação com treinamento ou capacidade atlética. Objetivou-se avaliar o perfil hematológico de eqüinos submetidos à prova de Team Penning, correlacionando o sexo e freqüência da atividade física. Mediante punção da veia jugular externa coletaram-se dois mL de sangue de 29 eqüinos, 18 machos e 11 fêmeas, em repouso (Momento I) e após o exercício (Momento II). As amostras de sangue foram processadas em analisador hematológico automático veterinário (ABC VET - Horiba ABX Diagnostics). Os animais foram divididos em Grupos A, B, C e D, de acordo com o número de participações na prova. Observou-se que os valores de volume globular, hemoglobina, hemácias, leucócitos, neutrófilos em bastonetes e segmentados, e monócitos aumentaram após o exercício físico, ao contrário do número de linfócitos e eosinófilos, que reduziram. Não existiram diferenças significativas (p<0,05) entre machos e fêmeas ao confrontar as relações antes/depois. Além disso, evidenciou-se que o valor da relação MI/MII para volume globular, hemoglobina e número de hemácias variou de acordo com a freqüência do exercício. Conclui-se que a prova de Team Peninng ocasiona alterações hematológicas em eqüinos, com interferência da freqüência do exercício, independente do sexo.

Application of the differential display RT-PCR strategy for the identification of inflammation-related mouse genes

The inflammatory response elicited by various stimuli such as microbial products or cytokines is determined by differences in the pattern of cellular gene expression. We have used the differential display RT-PCR (DDRT-PCR) strategy to identify mRNAs that are differentially expressed in various murine cell types stimulated with pro-inflammatory cytokines, microbial products or anti-inflammatory drugs. Mouse embryonic fibroblasts (MEFs) were treated with IFNs, TNF, or sodium salicylate. Also, peritoneal macrophages from C3H/Hej mice were stimulated with T. cruzi-derived GPI-mucin and/or IFN-g. After DDRT-PCR, various cDNA fragments that were differentially represented on the sequencing gel were recovered, cloned and sequenced. Here, we describe a summary of several experiments and show that, when 16 of a total of 28 recovered fragments were tested for differential expression, 5 (31%) were found to represent mRNAs whose steady-state levels are indeed modulated by the original stimuli. Some of the identified cDNAs encode for known proteins that were not previously associated with the inflammatory process triggered by the original stimuli. Other cDNA fragments (8 of 21 sequences, or 38%) showed no significant homology with known sequences and represent new mouse genes whose characterization might contribute to our understanding of inflammation. In conclusion, DDRT-PCR has proven to be a potent technology that will allow us to identify genes that are differentially expressed when cells are subjected to changes in culture conditions or isolated from different organs.

A simple RT-PCR-based strategy for screening connexin identity

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

Comparison of the quantitative competitive and semiquantitative RT-PCR methods for the determination of interferon-gamma mRNA levels in AIDS-free HIV-infected individuals

IFN-gamma mRNA expression was evaluated in nonstimulated peripheral blood mononuclear cells (PBMC) of HIV-infected and seronegative individuals using quantitative competitive and semiquantitative RT-PCR and the sensitivity of these methods was compared. A significant correlation was found between quantitative competitive and semiquantitative RT-PCR in samples of both HIV-seronegative (P = 0.004) and HIV-infected individuals (P = 0.0004). PBMC from HIV-infected individuals presented a remarkable increase of IFN-gamma mRNA expression, as determined by both types of RT-PCR methods. Semiquantitative RT-PCR even without an internal standard is also acceptable for measuring cytokine mRNA expression, but less reliable if small amounts are quantified. Moreover, we found that increased IFN-gammamRNA expression is independent of CD4+ cell count in AIDS-free HIV-infected patients.

Standard-curve competitive RT-PCR quantification of myogenic regulatory factors in chicken embryos

The reverse transcription-polymerase chain reaction (RT-PCR) is the most sensitive method used to evaluate gene expression. Although many advances have been made since quantitative RT-PCR was first described, few reports deal with the mathematical bases of this technique. The aim of the present study was to develop and standardize a competitive PCR method using standard-curves to quantify transcripts of the myogenic regulatory factors MyoD, Myf-5, Myogenin and MRF4 in chicken embryos. Competitor cDNA molecules were constructed for each gene under study using deletion primers, which were designed to maintain the anchorage sites for the primers used to amplify target cDNAs. Standard-curves were prepared by co-amplification of different amounts of target cDNA with a constant amount of competitor. The content of specific mRNAs in embryo cDNAs was determined after PCR with a known amount of competitor and comparison to standard-curves. Transcripts of the housekeeping ß-actin gene were measured to normalize the results. As predicted by the model, most of the standard-curves showed a slope close to 1, while intercepts varied depending on the relative efficiency of competitor amplification. The sensitivity of the RT-PCR method permitted the detection of as few as 60 MyoD/Myf-5 molecules per reaction but approximately 600 molecules of MRF4/Myogenin mRNAS were necessary to produce a measurable signal. A coefficient of variation of 6 to 19% was estimated for the different genes analyzed (6 to 9 repetitions). The competitive RT-PCR assay described here is sensitive, precise and allows quantification of up to 9 transcripts from a single cDNA sample.

The role of the vagus nerve in hypertonic resuscitation of hemorrhagic shocked dogs

Previous studies have suggested a critical role for the vagi during the hypertonic resuscitation of hemorrhagic shocked dogs. Vagal blockade prevented the full hemodynamic and metabolic recovery and increased mortality. This interpretation, however, was challenged on the grounds that the blockade also abolished critical compensatory mechanisms and therefore the animals would die regardless of treatment. To test this hypothesis, 29 dogs were bled (46.0 ± 6.2 ml/kg, enough to reduce the mean arterial pressure to 40 mmHg) and held hypotensive for 45 min. After 40 min, vagal activity was blocked in a reversible manner (0ºC/15 min) and animals were resuscitated with 7.5% NaCl (4 ml/kg), 0.9% NaCl (32 ml/kg), or the total volume of shed blood. In the vagal blocked isotonic saline group, 9 of 9 dogs, and in the vagal blocked replaced blood group, 11 of 11 dogs survived, with full hemodynamic and metabolic recovery. However, in the hypertonic vagal blocked group, 8 of 9 dogs died within 96 h. Survival of shocked dogs which received hypertonic saline solution was dependent on vagal integrity, while animals which received isotonic solution or blood did not need this neural component. Therefore, we conclude that hypertonic resuscitation is dependent on a neural component and not only on the transient plasma volume expansion or direct effects of hyperosmolarity on vascular reactivity or changes in myocardial contraction observed immediately after the beginning of infusion.

Fuzzy expert system in the prediction of neonatal resuscitation

In view of the importance of anticipating the occurrence of critical situations in medicine, we propose the use of a fuzzy expert system to predict the need for advanced neonatal resuscitation efforts in the delivery room. This system relates the maternal medical, obstetric and neonatal characteristics to the clinical conditions of the newborn, providing a risk measurement of need of advanced neonatal resuscitation measures. It is structured as a fuzzy composition developed on the basis of the subjective perception of danger of nine neonatologists facing 61 antenatal and intrapartum clinical situations which provide a degree of association with the risk of occurrence of perinatal asphyxia. The resulting relational matrix describes the association between clinical factors and risk of perinatal asphyxia. Analyzing the inputs of the presence or absence of all 61 clinical factors, the system returns the rate of risk of perinatal asphyxia as output. A prospectively collected series of 304 cases of perinatal care was analyzed to ascertain system performance. The fuzzy expert system presented a sensitivity of 76.5% and specificity of 94.8% in the identification of the need for advanced neonatal resuscitation measures, considering a cut-off value of 5 on a scale ranging from 0 to 10. The area under the receiver operating characteristic curve was 0.93. The identification of risk situations plays an important role in the planning of health care. These preliminary results encourage us to develop further studies and to refine this model, which is intended to implement an auxiliary system able to help health care staff to make decisions in perinatal care.

Comparison of the effects of lactated Ringer solution with and without hydroxyethyl starch fluid resuscitation on gut edema during severe splanchnic ischemia

The type of fluid used during resuscitation may have an important impact on tissue edema. We evaluated the impact of two different regimens of fluid resuscitation on hemodynamics and on lung and intestinal edema during splanchnic hypoperfusion in rabbits. The study included 16 female New Zealand rabbits (2.9 to 3.3 kg body weight, aged 8 to 12 months) with splanchnic ischemia induced by ligation of the superior mesenteric artery. The animals were randomized into two experimental groups: group I (N = 9) received 12 mL·kg-1·h-1 lactated Ringer solution and 20 mL/kg 6% hydroxyethyl starch solution; group II (N = 7) received 36 mL·kg-1·h-1 lactated Ringer solution and 20 mL/kg 0.9% saline. A segment from the ileum was isolated to be perfused. A tonometric catheter was placed in a second gut segment. Superior mesenteric artery (Q SMA) and aortic (Qaorta) flows were measured using ultrasonic flow probes. After 4 h of fluid resuscitation, tissue specimens were immediately removed for estimations of gut and lung edema. There were no differences in global and regional perfusion variables, lung wet-to-dry weight ratios and oxygenation indices between groups. Gut wet-to-dry weight ratio was significantly lower in the crystalloid/colloid-treated group (4.9 ± 1.5) than in the crystalloid-treated group (7.3 ± 2.4) (P < 0.05). In this model of intestinal ischemia, fluid resuscitation with crystalloids caused more gut edema than a combination of crystalloids and colloids.

Treatment of hemorrhagic shock with hypertonic saline solution modulates the inflammatory response to live bacteria in lungs

Shock and resuscitation render patients more susceptible to acute lung injury due to an exacerbated immune response to subsequent inflammatory stimuli. To study the role of innate immunity in this situation, we investigated acute lung injury in an experimental model of ischemia-reperfusion (I-R) followed by an early challenge with live bacteria. Conscious rats (N = 8 in each group) were submitted to controlled hemorrhage and resuscitated with isotonic saline (SS, 0.9% NaCl) or hypertonic saline (HS, 7.5% NaCl) solution, followed by intratracheal or intraperitoneal inoculation of Escherichia coli. After infection, toll-like receptor (TLR) 2 and 4 mRNA expression was monitored by RT-PCR in infected tissues. Plasma levels of tumor necrosis factor α and interleukins 6 and 10 were determined by ELISA. All animals showed similar hemodynamic variables, with mean arterial pressure decreasing to nearly 40 mmHg after bleeding. HS or SS used as resuscitation fluid yielded equal hemodynamic results. Intratracheal E. coli inoculation per se induced a marked neutrophil infiltration in septa and inside the alveoli, while intraperitoneal inoculation-associated neutrophils and edema were restricted to the interseptal space. Previous I-R enhanced lung neutrophil infiltration upon bacterial challenge when SS was used as reperfusion fluid, whereas neutrophil influx was unchanged in HS-treated animals. No difference in TLR expression or cytokine secretion was detected between groups receiving HS or SS. We conclude that HS is effective in reducing the early inflammatory response to infection after I-R, and that this phenomenon is achieved by modulation of factors other than expression of innate immunity components.

Rabbit model of uncontrolled hemorrhagic shock and hypotensive resuscitation

Clinically relevant animal models capable of simulating traumatic hemorrhagic shock are needed. We developed a hemorrhagic shock model with male New Zealand rabbits (2200-2800 g, 60-70 days old) that simulates the pre-hospital and acute care of a penetrating trauma victim in an urban scenario using current resuscitation strategies. A laparotomy was performed to reproduce tissue trauma and an aortic injury was created using a standardized single puncture to the left side of the infrarenal aorta to induce hemorrhagic shock similar to a penetrating mechanism. A 15-min interval was used to simulate the arrival of pre-hospital care. Fluid resuscitation was then applied using two regimens: normotensive resuscitation to achieve baseline mean arterial blood pressure (MAP, 10 animals) and hypotensive resuscitation at 60% of baseline MAP (10 animals). Another 10 animals were sham operated. The total time of the experiment was 85 min, reproducing scene, transport and emergency room times. Intra-abdominal blood loss was significantly greater in animals that underwent normotensive resuscitation compared to hypotensive resuscitation (17.1 ± 2.0 vs 8.0 ± 1.5 mL/kg). Antithrombin levels decreased significantly in normotensive resuscitated animals compared to baseline (102 ± 2.0 vs 59 ± 4.1%), sham (95 ± 2.8 vs 59 ± 4.1%), and hypotensive resuscitated animals (98 ± 7.8 vs 59 ± 4.1%). Evidence of re-bleeding was also noted in the normotensive resuscitation group. A hypotensive resuscitation regimen resulted in decreased blood loss in a clinically relevant small animal model capable of reproducing hemorrhagic shock caused by a penetrating mechanism.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.