45 resultados para Post-transcriptional Gene Silencing


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The control of CD4 gene expression is essential for proper T lymphocyte development. Signals transmitted from the T-cell antigen receptor (TCR) during the thymic selection processes are believed to be linked to the regulation of CD4 gene expression during specific stages of T cell development. Thus, a study of the factors that control CD4 gene expression may lead to further insight into the molecular mechanisms that drive thymic selection. In this review, we discuss the work conducted to date to identify and characterize the cis-acting transcriptional control elements in the CD4 locus and the DNA-binding factors that mediate their function. From these studies, it is becoming clear that the molecular mechanisms controlling CD4 gene expression are very complex and differ at each stage of development. Thus, the control of CD4 expression is subject to many different influences as the thymocyte develops.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The RECK gene was initially isolated as a transformation suppressor gene encoding a novel membrane-anchored glycoprotein and later found to suppress tumor invasion and metastasis by regulating matrix metalloproteinase-9. Its expression is ubiquitous in normal tissues, but undetectable in many tumor cell lines and in fibroblastic lines transformed by various oncogenes. The RECK gene promoter has been cloned and characterized. One of the elements responsible for the oncogene-mediated downregulation of mouse RECK gene is the Sp1 site, where the Sp1 and Sp3 factors bind. Sp1 transcription factor family is involved in the basal level of promoter activity of many genes, as well as in dynamic regulation of gene expression; in a majority of cases as a positive regulator, or, as exemplified by the oncogene-mediated suppression of RECK gene expression, as a negative transcription regulator. The molecular mechanisms of the downregulation of mouse RECK gene and other tumor suppressor genes are just beginning to be uncovered. Understanding the regulation of these genes may help to develop strategies to restore their expression in tumor cells and, hence, suppress the cells' malignant behavior.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Interactions of viral proteins play an important role in the virus life cycle, especially in capsid assembly. Andean potato mottle comovirus (APMoV) is a plant RNA virus with a virion formed by two coat proteins (CP42 and CP22). Both APMoV coat protein open reading frames were cloned into pGBT9 and pGAD10, two-hybrid system vectors. HF7c yeast cells transformed with the p9CP42 construct grew on yeast dropout selection media lacking tryptophan and histidine. Clones also exhibited ß-galactosidase activity in both qualitative and quantitative assays. These results suggest that CP42 protein contains an amino acid motif able to activate transcription of His3 and lacZ reporter genes in Saccharomyces cerevisiae. Several deletions of the CP42 gene were cloned into the pGBT9 vector to locate the region involved in this activation. CP42 constructions lacking 12 residues from the C-terminal region and another one with 267 residues deleted from the N-terminus are still able to activate transcription of reporter genes. However, transcription activation was not observed with construction p9CP42deltaC57, which does not contain the last 57 amino acid residues. These results demonstrate that a transcription activation domain is present at the C-terminus of CP42 between residues 267 and 374.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The uncoupling protein UCP3 belongs to a family of mitochondrial carriers located in the inner mitochondrial membrane of certain cell types. It is expressed almost exclusively at high levels in skeletal muscle and its physiological role has not been fully determined in this tissue. In the present study we have addressed the possible interaction between a hypercaloric diet and thyroid hormone (T3), which are strong stimulators of UCP3 gene expression in skeletal muscle. Male Wistar rats weighing 180 ± 20 g were rendered hypothyroid by thyroidectomy and the addition of methimazole (0.05%; w/v) to drinking water after surgery. The rats were fed a hypercaloric cafeteria diet (68% carbohydrates, 13% protein and 18% lipids) for 10 days and sacrificed by decapitation. Subsequently, the gastrocnemius muscle was dissected, total RNA was isolated with Trizol™ and UCP3 gene expression was determined by Northern blotting using a specific probe. Statistical analysis was performed by one-way analysis of variance (ANOVA) followed by the Student-Newman-Keuls post-test. Skeletal muscle UCP3 gene expression was decreased by 60% in hypothyroid rats and UCP3 mRNA expression was increased 70% in euthyroid cafeteria-fed rats compared to euthyroid chow-fed animals, confirming previous studies. Interestingly, the cafeteria diet was unable to stimulate UCP3 gene expression in hypothyroid animals (40% lower as compared to euthyroid cafeteria-fed animals). The results show that a hypercaloric diet is a strong stimulator of UCP3 gene expression in skeletal muscle and requires T3 for an adequate action.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have studied the molecular mechanism and signal transduction of pim-1, an oncogene encoding a serine-threonine kinase. This is a true oncogene which prolongs survival and inhibits apoptosis of hematopoietic cells. In order to determine whether the effects of Pim-1 occur by regulation of the mitogen-activated protein kinase pathway, we used a transcriptional reporter assay by transient co-transfection as a screening method. In this study, we found that Pim-1 inhibited the Elk-1 and NFkappaB transcriptional activities induced by activation of the mitogen-activated protein kinase cascade in reporter gene assays. However, Western blots showed that the induction of Elk-1-regulated expression of endogenous c-Fos was not affected by Pim-1. The phosphorylation and activation of neither Erk1/2 nor Elk-1 was influenced by Pim-1. Also, in the gel shift assay, the pattern of endogenous NFkappaB binding to its probe was not changed in any manner by Pim-1. These data indicate that Pim-1 does not regulate the activation of Erk1/2, Elk-1 or NFkappaB. These contrasting results suggest a pitfall of the transient co-transfection reporter assay in analyzing the regulation of transcription factors outside of the chromosome context. It ensures that results from reporter gene expression assay should be verified by study of endogenous gene expression.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We report a fast (less than 3 h) and cost-effective melting temperature assay method for the detection of single-nucleotide polymorphisms in the MBL2 gene. The protocol, which is based on the Corbett Rotor Gene real time PCR platform and SYBR Green I chemistry, yielded, in the cohorts studied, sensitive (100%) and specific (100%) PCR amplification without the use of costly fluorophore-labeled probes or post-PCR manipulation. At the end of the PCR, the dissociation protocol included a slow heating from 60º to 95ºC in 0.2ºC steps, with an 8-s interval between steps. Melting curve profiles were obtained using the dissociation software of the Rotor Gene-3000 apparatus. Samples were analyzed in duplicate and in different PCR runs to test the reproducibility of this technique. No supplementary data handling is required to determine the MBL2 genotype. MBL2 genotyping performed on a cohort of 164 HIV-1-positive Brazilian children and 150 healthy controls, matched for age and sex and ethnic origin, yielded reproducible results confirmed by direct sequencing of the amplicon performed in blind. The three MBL2 variants (Arg52Cys, Gly54Asp, Gly57Glu) were grouped together and called allele 0, while the combination of three wild-type alleles was called allele A. The frequency of the A/A homozygotes was significantly higher among healthy controls (0.68) than in HIV-infected children (0.55; P = 0.0234) and the frequency of MBL2 0/0 homozygotes was higher among HIV-1-infected children than healthy controls (P = 0.0296). The 0 allele was significantly more frequent among the 164 HIV-1-infected children (0.29) than among the 150 healthy controls (0.18; P = 0.0032). Our data confirm the association between the presence of the mutated MBL2 allele (allele 0) and HIV-1 infection in perinatally exposed children. Our results are in agreement with the literature data which indicate that the presence of the allele 0 confers a relative risk of 1.37 for HIV-1 infection through vertical transmission.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Most breast cancer risk factors are associated with prolonged exposure of the mammary gland to high levels of estrogens. The actions of estrogens are predominantly mediated by two receptors, ERα and ERβ, which act as transcription factors binding with high affinity to estrogen response elements in the promoter region of target genes. However, most target genes do not contain the consensus estrogen response elements, but rather degenerated palindromic sequences showing one or more mutations and other ER-binding sites such as AP-1 and SP-1. Using the differential display reverse transcription-polymerase chain reaction technique, our group identified several genes differentially expressed in normal tissue and in ER-positive and ER-negative primary breast tumors. One of the genes shown to be down-regulated in breast tumors compared to normal breast tissue was the PHLDA1 (Pleckstrin homology-like domain, family A, member 1). In the present study, we investigated the potential of PHLDA1 to be regulated by estrogen via ER in MCF-7 breast cancer cells. The promoter region of PHLDA1 shows an imperfect palindrome, an AP-1- and three SP-1-binding sites potentially regulated by estrogens. We also assessed the effects of 17β-estradiol on PHLDA1 mRNA expression in MCF-7 breast cancer cells. MCF-7 cells exposed to 10 nM 17β-estradiol showed more than 2-fold increased expression of the PHLDA1 transcripts compared to control cells (P = 0.05). The anti-estrogen ICI 182,780 (1 µM) inhibited PHLDA1 mRNA expression and completely abolished the effect of 10 nM 17β-estradiol on PHLDA1 expression (P < 0.05), suggesting that PHLDA1 is regulated by estrogen via ER.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Since the anti-inflammatory, antidiabetic and hypolipidemic effects of soy isoflavones may be mediated by activation of peroxisome proliferator-activated receptors (PPAR), the present study investigated whether the methanolic fractions obtained from soybean seeds (E1) and soybean seed coats with hypocotyls (E2) could influence PPARα, PPARγ and PPARβ/δ transcriptional activity. The isoflavones from E1 and E2 were quantified by HPLC analysis. E1 and E2 were rich in isoflavones (daidzin, glycitin, genistin, malonyldaidzin, malonylglycitin, malonylgenistin, daidzein, glycitein, and genistein). Moreover, E1 and E2 showed no evidence of genetically modified material containing the gene CP4 EPSPS. To investigate PPAR transcriptional activity, human promonocytic U-937 cells were treated with E1 and E2 (200, 400, 800, and 1600 µg/mL), positive controls or vehicle. Data are reported as fold-activation of the luciferase reporter driven by the PPAR-responsive element. Dose-response analysis revealed that E1 and E2 induced the transcriptional activity of PPARα (P < 0.001), with activation comparable to that obtained with 0.1 mM bezafibrate (positive control) at 1600 µg/mL (4-fold) and 800 µg/mL (9-fold), respectively. In addition, dose-response analysis revealed that E1 and E2 activated PPARβ/δ (P < 0.05), and the activation at 800 µg/mL (4- and 9-fold, respectively) was comparable to that of 0.1 mM bezafibrate (positive control). However, no effect on PPARγ was observed. Activation of PPARα is consistent with the lipid-lowering activity of soy isoflavones in vivo, but further studies are needed to determine the physiological significance of PPARβ/δ activation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Chronic hepatitis B (HBV) and C (HCV) virus infections are the most important factors associated with hepatocellular carcinoma (HCC), but tumor prognosis remains poor due to the lack of diagnostic biomarkers. In order to identify novel diagnostic markers and therapeutic targets, the gene expression profile associated with viral and non-viral HCC was assessed in 9 tumor samples by oligo-microarrays. The differentially expressed genes were examined using a z-score and KEGG pathway for the search of ontological biological processes. We selected a non-redundant set of 15 genes with the lowest P value for clustering samples into three groups using the non-supervised algorithm k-means. Fisher’s linear discriminant analysis was then applied in an exhaustive search of trios of genes that could be used to build classifiers for class distinction. Different transcriptional levels of genes were identified in HCC of different etiologies and from different HCC samples. When comparing HBV-HCC vs HCV-HCC, HBV-HCC/HCV-HCC vs non-viral (NV)-HCC, HBC-HCC vs NV-HCC, and HCV-HCC vs NV-HCC of the 58 non-redundant differentially expressed genes, only 6 genes (IKBKβ, CREBBP, WNT10B, PRDX6, ITGAV, and IFNAR1) were found to be associated with hepatic carcinogenesis. By combining trios, classifiers could be generated, which correctly classified 100% of the samples. This expression profiling may provide a useful tool for research into the pathophysiology of HCC. A detailed understanding of how these distinct genes are involved in molecular pathways is of fundamental importance to the development of effective HCC chemoprevention and treatment.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Bovine herpesvirus 5 (BoHV-5), the agent of herpetic meningoencephalitis in cattle, is an important pathogen of cattle in South America and several efforts have been made to produce safer and more effective vaccines. In the present study, we investigated in rabbits the virulence of three recombinant viruses constructed from a neurovirulent Brazilian BoHV-5 strain (SV507/99). The recombinants are defective in glycoprotein E (BoHV-5gEΔ), thymidine kinase (BoHV-5TKΔ) and both proteins (BoHV-5gEΔTKΔ). Rabbits inoculated with the parental virus (N = 8) developed neurological disease and died or were euthanized in extremis between days 7 and 13 post-infection (pi). Infectivity was detected in several areas of their brains. Three of 8 rabbits inoculated with the recombinant BoHV-5gEΔ developed neurological signs between days 10 and 15 pi and were also euthanized. A more restricted virus distribution was detected in the brain of these animals. Rabbits inoculated with the recombinants BoHV-5TKΔ (N = 8) or BoHV-5gEΔTKΔ (N = 8) remained healthy throughout the experiment in spite of variable levels of virus replication in the nose. Dexamethasone (Dx) administration to rabbits inoculated with the three recombinants at day 42 pi did not result in viral reactivation, as demonstrated by absence of virus shedding and/or increase in virus neutralizing titers. Nevertheless, viral DNA was detected in the trigeminal ganglia or olfactory bulbs of all animals at day 28 post-Dx, demonstrating they were latently infected. These results show that recombinants BoHV-5TKΔ and BoHV-5gEΔTKΔ are attenuated for rabbits and constitute potential vaccine candidates upon the confirmation of this phenotype in cattle.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Male sex determination in humans is controlled by the SRY gene, which encodes a transcriptional regulator containing a conserved high mobility group box domain (HMG-box) required for DNA binding. Mutations in the SRY HMG-box affect protein function, causing sex reversal phenotypes. In the present study, we describe a 19-year-old female presenting 46,XY karyotype with hypogonadism and primary amenorrhea that led to the diagnosis of 46,XY complete gonadal dysgenesis. The novel p.E89K missense mutation in the SRY HMG-box was identified as a de novo mutation. Electrophoretic mobility shift assays showed that p.E89K almost completely abolished SRY DNA-binding activity, suggesting that it is the cause of SRY function impairment. In addition, we report the occurrence of the p.G95R mutation in a 46,XY female with complete gonadal dysgenesis. According to the three-dimensional structure of the human SRY HMG-box, the substitution of the conserved glutamic acid residue by the basic lysine at position 89 introduces an extra positive charge adjacent to and between the positively charged residues R86 and K92, important for stabilizing the HMG-box helix 2 with DNA. Thus, we propose that an electrostatic repulsion caused by the proximity of these positive charges could destabilize the tip of helix 2, abrogating DNA interaction.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The reduction of hepatic microsomal transfer protein (MTP) activity results in fatty liver, worsening hepatic steatosis and fibrosis in chronic hepatitis C (CHC). The G allele of the MTP gene promoter, -493G/T, has been associated with lower transcriptional activity than the T allele. We investigated this association with metabolic and histological variables in patients with CHC. A total of 174 untreated patients with CHC were genotyped for MTP -493G/T by direct sequencing using PCR. All patients were negative for markers of Wilson’s disease, hemochromatosis and autoimmune diseases and had current and past daily alcohol intake lower than 100 g/week. The sample distribution was in Hardy-Weinberg equilibrium. Among subjects with genotype 1, 56.8% of the patients with fibrosis grade 3+4 presented at least one G allele versus 34.3% of the patients with fibrosis grade 1+2 (OR = 1.8; 95%CI = 1.3-2.3). Logistic regression analysis with steatosis as the dependent variable identified genotypes GG+GT as independent protective factors against steatosis (OR = 0.4, 95%CI = 0.2-0.8; P = 0.01). The results suggest that the presence of the G allele of MTP -493G/T associated with lower hepatic MTP expression protects against steatosis in our CHC patients.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In this study, biomarkers and transcriptional factor motifs were identified in order to investigate the etiology and phenotypic severity of Down syndrome. GSE 1281, GSE 1611, and GSE 5390 were downloaded from the gene expression ominibus (GEO). A robust multiarray analysis (RMA) algorithm was applied to detect differentially expressed genes (DEGs). In order to screen for biological pathways and to interrogate the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database, the database for annotation, visualization, and integrated discovery (DAVID) was used to carry out a gene ontology (GO) function enrichment for DEGs. Finally, a transcriptional regulatory network was constructed, and a hypergeometric distribution test was applied to select for significantly enriched transcriptional factor motifs. CBR1, DYRK1A, HMGN1, ITSN1, RCAN1, SON, TMEM50B, and TTC3 were each up-regulated two-fold in Down syndrome samples compared to normal samples; of these, SON and TTC3 were newly reported. CBR1, DYRK1A, HMGN1, ITSN1, RCAN1, SON, TMEM50B, and TTC3 were located on human chromosome 21 (mouse chromosome 16). The DEGs were significantly enriched in macromolecular complex subunit organization and focal adhesion pathways. Eleven significantly enriched transcription factor motifs (PAX5, EGR1, XBP1, SREBP1, OLF1, MZF1, NFY, NFKAPPAB, MYCMAX, NFE2, and RP58) were identified. The DEGs and transcription factor motifs identified in our study provide biomarkers for the understanding of Down syndrome pathogenesis and progression.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A bovine herpesvirus 1 (BoHV-1) defective in glycoprotein E (gE) was constructed from a Brazilian genital BoHV-1 isolate, by replacing the full gE coding region with the green fluorescent protein (GFP) gene for selection. Upon co-transfection of MDBK cells with genomic viral DNA plus the GFP-bearing gE-deletion plasmid, three fluorescent recombinant clones were obtained out of approximately 5000 viral plaques. Deletion of the gE gene and the presence of the GFP marker in the genome of recombinant viruses were confirmed by PCR. Despite forming smaller plaques, the BoHV-1△gE recombinants replicated in MDBK cells with similar kinetics and to similar titers to that of the parental virus (SV56/90), demonstrating that the gE deletion had no deleterious effects on replication efficacy in vitro. Thirteen calves inoculated intramuscularly with BoHV-1△gE developed virus neutralizing antibodies at day 42 post-infection (titers from 2 to 16), demonstrating the ability of the recombinant to replicate and to induce a serological response in vivo. Furthermore, the serological response induced by recombinant BoHV-1△gE could be differentiated from that induced by wild-type BoHV-1 by the use of an anti-gE antibody ELISA kit. Taken together, these results indicated the potential application of recombinant BoHV-1 △gE in vaccine formulations to prevent the losses caused by BoHV-1 infections while allowing for differentiation of vaccinated from naturally infected animals.