In vitro modulation of Bcl-2 levels in small cell lung cancer cells: effects on cell viability

Small cell lung cancer (SCLC) is an aggressive disease, representing 15% of all cases of lung cancer, has high metastatic potential and low prognosis that urgently demands the development of novel therapeutic approaches. One of the proposed approaches has been the down-regulation of BCL2, with poorly clarified and controversial therapeutic value regarding SCLC. The use of anti-BCL2 small interfering RNA (siRNA) in SCLC has never been reported. The aim of the present study was to select and test the in vitro efficacy of anti-BCL2 siRNA sequences against the protein and mRNA levels of SCLC cells, and their effects on cytotoxicity and chemosensitization. Two anti-BCL2 siRNAs and the anti-BCL2 G3139 oligodeoxynucleotide (ODN) were evaluated in SCLC cells by the simultaneous determination of Bcl-2 and viability using a flow cytometry method recently developed by us in addition to Western blot, real-time reverse-transcription PCR, and cell growth after single and combined treatment with cisplatin. In contrast to previous reports about the use of ODN, a heterogeneous and up to 80% sequence-specific Bcl-2 protein knockdown was observed in the SW2, H2171 and H69 SCLC cell lines, although without significant sequence-specific reduction of cell viability, cell growth, or sensitization to cisplatin. Our results question previous data generated with antisense ODN and supporting the present concept of the therapeutic interest in BCL2 silencing per se in SCLC, and support the growing notion of the necessity of a multitargeting molecular approach for the treatment of cancer.

Association of Bartonella spp bacteremia with Chagas cardiomyopathy, endocarditis and arrythmias in patients from South America

Infection with Bartonella spp may cause cardiac arrhythmias, myocarditis and endocarditis in humans. The aim of the present study was to evaluate a possible association between Bartonella spp bacteremia and endocarditis, arrhythmia and Chagas cardiomyopathy in patients from Brazil and Argentina. We screened for the presence of bacterial 16S rRNA in human blood by PCR using oligonucleotides to amplify a 185-bp bacterial DNA fragment. Blood samples were taken from four groups of subjects in Brazil and Argentina: i) control patients without clinical disease, ii) patients with negative blood-culture endocarditis, iii) patients with arrhythmias, and iv) patients with chronic Chagas cardiomyopathy. PCR products were analyzed on 1.5% agarose gel to visualize the 185-bp fragment and then sequenced to confirm the identity of DNA. Sixty of 148 patients (40.5%) with cardiac disease and 1 of 56 subjects (1.8%) from the control group presented positive PCR amplification for Bartonella spp, suggesting a positive association of the bacteria with these diseases. Separate analysis of the four groups showed that the risk of a Brazilian patient with endocarditis being infected with Bartonella was 22 times higher than in the controls. In arrhythmic patients, the prevalence of infection was 45 times higher when compared to the same controls and 40 times higher for patients with Chagas cardiomyopathy. To the best of our knowledge this is the first report of the association between Bartonella spp bacteremia and Chagas disease. The present data may be useful for epidemiological and prevention studies in Brazil and Argentina.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.