140 resultados para Identification Test Audit


Relevância:

30.00% 30.00%

Publicador:

Resumo:

An excreted iron superoxide dismutase (FeSODe) of pI 3.6 with a molecular weight of 28-30 kDa was detected in the in vitro culture of Phytomonas isolated from Euphorbia characias (SODeCHA) and from Lycopersicon esculentum (SODeTOM), in Grace's medium without serum. These FeSODe excreted into the medium had immunogenic capacity: the positivity of the anti-SODeCHA serum persisted to a dilution of 1/30,000, and for the anti-SODeTOM to 1/10,000 by Western blot. In addition, cross reaction was detected between the anti-SODe serum of Phytomonas isolated from E. characias against SODeTOM, and the anti-SODe serum from L. esculentum with SODeCHA. This characteristic offers the possibility of its use to diagnose plant trypanosomatids. The validation of the test was confirmed by experimental inoculation of tomato fruits with Phytomonas isolated from L. esculentum. At 7, 10, 15, and 21 days post infection, it was possible to detect the presence of the parasites with the anti-SODe serum of Phytomonas isolated from L. esculentum at a dilution of 1/250. These serological results were confirmed by visualization of the parasites by optical microscopy. The data of this study confirm that the SOD is sufficient to identify a trypanosomatid isolated from plants as belonging to the genus Phytomonas.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Mycobacterium was verified in animals from a Brazilian dairy herd, a total of 42 samples from 30 cows were submitted to culture and the isolated strains were analyzed by two polymerase chain reaction (PCR), the first specific for species belonging to the Mycobacterium complex (MTBC) and the other for differentiating M. tuberculosis from M. bovis. Twenty seven samples (64.3%) from 18 animals (60%) were positive for mycobacteria by culture, including samples from 15 retrofaryngeal lymphnodes (55.5%), 9 prescapular lymphnodes (33.3%), 2 lungs (7.4%), and 1 liver (3.7%). All isolated colonies were confirmed by PCR to contain MTBC organisms, and were identified as M. bovis by the same methodology.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We evaluated the ability of a PCR assay to identify Mycobacterium tuberculosis complex (MTBC) from positive BACTEC® 12B broth cultures. A total of 107 sputum samples were processed and inoculated into Ogawa slants and BACTEC® 12B vials. At a growth index (GI) > 30, 1.0 ml of the 12B broth was removed, stored, and assayed with PCR. Molecular results were compared to those obtained by phenotypic identification methods, including the BACTEC® NAP method. The average times required to perform PCR and NAP were compared. Of the 107 broth cultures evaluated, 90 were NAP positive, while 91 were PCR positive for MTBC. Of particular interest were three contaminated BACTEC® 12B broth cultures yielding microorganisms other than acid-fast bacilli growth with a MTBC that were successfully identified by PCR, resulting in a mean time of 14 days to identify MTBC before NAP identification. These results suggest that PCR could be used as an alternative to the NAP test for the rapid identification of MTBC in BACTEC® 12B cultures, particularly in those that contained both MTBC and nontuberculous mycobacteria.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The development of a more sensitive diagnostic test for schistosomiasis is needed to overcome the limitations of the use of stool examination in low endemic areas. Using parasite antigens in enzyme linked immunosorbent assay is a promising strategy, however a more rational selection of parasite antigens is necessary. In this study we performed in silico analysis of the Schistosoma mansoni genome, using SchistoDB database and bioinformatic tools for screening immunogenic antigens. Based on evidence of expression in all parasite life stage within the definitive host, extracellular or plasmatic membrane localization, low similarity to human and other helminthic proteins and presence of predicted B cell epitopes, six candidates were selected: a glycosylphosphatidylinositol-anchored 200 kDa protein, two putative cytochrome oxidase subunits, two expressed proteins and one hypothetical protein. The recognition in unidimensional and bidimensional Western blot of protein with similar molecular weight and isoelectric point to the selected antigens by sera from S. mansoni infected mice indicate a good correlation between these two approaches in selecting immunogenic proteins.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Sequences of the cytochrome c oxidase subunit I (COI) mitochondrial gene from adults of 22 Culex ( Culex ) species from Argentina and Brazil were employed to assess species identification and to test the usefulness of COI for barcoding using the best close match (BCM) algorithm. A pairwise Kimura two-parameter distance matrix including the mean intra and interspecific distances for 71 COI barcode sequences was constructed. Of the 12 COI lineages recovered in the Neighbour-joining topology, five confirmed recognised morphological species ( Cx. acharistus , Cx. chidesteri , Cx. dolosus , Cx. lygrus and Cx. saltanensis ) with intraspecific divergences lower than 1.75%. Cx. bilineatus is formally resurrected from the synonymy of Cx. dolosus . Cx. maxi , Cx. surinamensis and the Coronator group species included were clustered into an unresolved lineage. The intraspecific distance of Cx. pipiens (3%) was almost twice the interspecific between it and Cx. quinquefasciatus (1.6%). Regarding the BCM criteria, the COI barcode successfully identified 69% of all species. The rest of the sequences, approximately 10%, 18% and 3%, remained as ambiguously, mis and unidentified, respectively. The COI barcode does not contain enough information to distinguish Culex ( Cux. ) species.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

ABSTRACT Trichoderma species are non-pathogenic microorganisms that protect against fungal diseases and contribute to increased crop yields. However, not all Trichoderma species have the same effects on crop or a pathogen, whereby the characterization and identification of strains at the species level is the first step in the use of a microorganism. The aim of this study was the identification – at species level – of five strains of Trichoderma isolated from soil samples obtained from garlic and onion fields located in Costa Rica, through the analysis of the ITS1, 5.8S, and ITS2 ribosomal RNA regions; as well as the determination of their individual antagonistic ability over S. cepivorum Berkeley. In order to distinguish the strains, the amplified products were analyzed using MEGA v6.0 software, calculating the genetic distances through the Tamura-Nei model and building the phylogenetic tree using the Maximum Likelihood method. We established that the evaluated strains belonged to the species T. harzianum and T. asperellum; however it was not possible to identify one of the analyzed strains based on the species criterion. To evaluate their antagonistic ability, the dual culture technique, Bell’s scale, and the percentage inhibition of radial growth (PIRG) were used, evidencing that one of the T. asperellum isolates presented the best yields under standard, solid fermentation conditions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The study was done to identify the most active fungitoxic component of cinnamon bark (Cinnamomum zeylanicum) oil that can be used as a marker for standardization of cinnamon extract or oil based natural preservative of stored seeds. Aspergillus flavus and A. ruber were used as test fungi. The hexane extracted crude oil and the hydro-distilled essential oil from cinnamon bark had complete growth inhibition concentration (CGIC) of 300 and 100 µl/l, respectively. Both oils produced three fractions on preparative thin layer silica-gel chromatography plates. The fraction-2 of either oil was the largest and most active, with CGIC of 200 µl/l, but the fungitoxicity was also retained in the other two fractions. The fraction-1 and 3 of the crude oil reduced growth of both the fungal species by 65%, and those of distilled oil by 45% at 200 µl/l. The CGIC of these fractions from both the sources was above 500 µl/l. The gas chromatography and mass spectrometry (GC-MS) of the fraction-2 of the hexane extract revealed that it contained 61% cinnamaldehyde, 29% cinnamic acid, and two minor unidentified compounds in the proportion of 4% and 6%. The GC-MS of the fraction-2 of the distilled oil revealed that it contained 99.1% cinnamaldehyde and 0.9% of an unidentified compound. The CGIC of synthetic cinnamaldehyde was 300 µl/l and that of cinnamic acid above 500 µl/l. The 1:1 mixture of cinnamaldehyde and cinnamic acid had CGIC of 500 µl/l. The data revealed that cinnamaldehyde was the major fungitoxic component of hexane extract and the distilled essential oil of cinnamon bark, while other components have additive or synergistic effects on total fungitoxicity. It is suggested that the natural seed preservative based on cinnamon oil can be standardized against cinnamaldehyde.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Among studies focused on increasing soybean grain yield, the ones related to sowing process are the most significant. Considering that soybean has an epigeal emergence, it becomes difficult to hint at the length covered by hypocotyl up to soil surface, or the actual planting depth. This study aimed to find an indicator that allows the identification of an ideal soybean planting depth. For this purpose, two complementary assays has been carried out in a greenhouse. The first aimed to identify structures that could be indicators of seed planting depth, on a medium-textured soil from Campos Gerais region, in the state of Paraná, Brazil. Spring NK 8350 cultivar seeds were sown at five theoretical depths (1, 2, 3, 4 and 5 cm). As seedlings emerged, the “differentiation zone” and the “root curve” depths were measured. The second assay was the validation of the suggested indicators in assay 1 from two soils, one medium-textured and one clay-textured. For this assay, it was used BRS 232. Both the methodologies showed high correlation with the theoretical planting depth. Although their correlation coefficient values were close, the differentiation zone appeared to be the most efficient reference with less planting depth overestimation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

ABSTRACT International trade in broiler’ feet, mainly to Asian markets, has demanded better quality control. The objective of this research was to study the suitability of using chicken footpad surface temperature to determine early lesions of pododermatitis. The project was conducted in two houses A1 and A2) in a commercial farm during one production flock. A1 had reused litter of wood shavings and rice hulls, and A2 had a new litter of sawdust. Both houses had positive pressure ventilation. The inner area of the poultry was virtually divided into three quadrants. The footpads were checked for the feet quality, and a degree of pododermatitis was awarded. Thermal images were made to test the surface temperature of the foot and identify inflammation in a total of 30 birds per house, at ages 5, 19, 29, 28 and 40 days of grow-out. Conditions of the rearing environment as well as the surface temperature of the litter, litter moisture, and degree of compression, were recorded. The environment within the houses did not differ. The surface temperatures of the footpad did not differ between the groups. The minimum footpad surface temperatures within the scores were similar, except for the score 3, which did not occur in A1. There was a prevalence of severe injury in the house with a new litter.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The accuracy of modelling of rotor systems composed of rotors, oil film bearings and a flexible foundation, is evaluated and discussed in this paper. The model validation of different models has been done by comparing experimental results with numerical results by means. The experimental data have been obtained with a fully instrumented four oil film bearing, two shafts test rig. The fault models are then used in the frame of a model based malfunction identification procedure, based on a least square fitting approach applied in the frequency domain. The capability of distinguishing different malfunctions has been investigated, even if they can create similar effects (such as unbalance, rotor bow, coupling misalignment and others) from shaft vibrations measured in correspondence of the bearings.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A three degree of freedom model of the dynamic mass at the middle of a test sample, resembling a Stockbridge neutraliser, is introduced. This model is used to identify the hereby called equivalent complex cross section flexural stiffness (ECFS) of the beam element which is part of the whole test sample. This ECFS, once identified, gives the effective cross section flexural stiffness of the beam as well as its effective damping, measured as the loss factor of an equivalent viscoelastic beam. The beam element of the test sample may be of any complexity, such as a segment of stranded cable of the ACSR type. These data are important parameters for the design of overhead power transmission lines and other cable structures. A cost function is defined and used in the identification of the ECFS. An experiment, designed to measure the dynamic masses of two test samples, is described. Experimental and identified results are presented and discussed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A three degree of freedom model of the dynamic mass at the middle of a test sample, resembling a Stockbridge neutraliser, is introduced. This model is used to identify the hereby called equivalent complex cross section flexural stiffness (ECFS) of the beam element which is part of the whole test sample. This ECFS, once identified, gives the effective cross section flexural stiffness of the beam as well as its effective damping, measured as the loss factor of an equivalent viscoelastic beam. The beam element of the test sample may be of any complexity, such as a segment of stranded cable of the ACSR type. These data are important parameters for the design of overhead power transmission lines and other cable structures. A cost function is defined and used in the identification of the ECFS. An experiment, designed to measure the dynamic masses of two test samples, is described. Experimental and identified results are presented and discussed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

It is presented a test bed applied to studies on dynamics, control, and navigation of mobile robots. A cargo ship scale model was chosen, which can be radio-controlled or operated autonomously through an embedded control system. A control program, which manages on board mission execution, is implemented on a microcontroller. Navigation is based on an electronic compass, which includes automatic compensation for pitch and roll motions. Heading control loop is based on this sensor, and on a rudder positioning system. A propulsion control system is also implemented. Typical manoeuvres as the turning test and "zig-zag", were implemented and tested. They are included on a manoeuvre library, and can be accessed independently or in combined modes. The embedded system is also in charge of signal acquisition and storing during the missions. It is possible to analyse experiments on identification of ship dynamics, control, and navigation, through the data transferred to a PC by serial communication. Navigation is going to be improved by including inertial sensors on board, and a DGPS. Preliminary tests are aimed to ship identification, and manoeuvrability, using free model tests. Future steps include extending this system for developing other mobile robots as, ROVs, AUVs, and aerial vehicles.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The aim of the present study was to assess the spectral behavior of the erector spinae muscle during isometric contractions performed before and after a dynamic manual load-lifting test carried out by the trunk in order to determine the capacity of muscle to perform this task. Nine healthy female students participated in the experiment. Their average age, height, and body mass (± SD) were 20 ± 1 years, 1.6 ± 0.03 m, and 53 ± 4 kg, respectively. The development of muscle fatigue was assessed by spectral analysis (median frequency) and root mean square with time. The test consisted of repeated bending movements from the trunk, starting from a 45º angle of flexion, with the application of approximately 15, 25 and 50% of maximum individual load, to the stand up position. The protocol used proved to be more reliable with loads exceeding 50% of the maximum for the identification of muscle fatigue by electromyography as a function of time. Most of the volunteers showed an increase in root mean square versus time on both the right (N = 7) and the left (N = 6) side, indicating a tendency to become fatigued. With respect to the changes in median frequency of the electromyographic signal, the loads used in this study had no significant effect on either the right or the left side of the erector spinae muscle at this frequency, suggesting that a higher amount and percentage of loads would produce more substantial results in the study of isotonic contractions.