Cellular and genetic mechanisms involved in the generation of protective and pathogenic immune responses in human Chagas disease

Perhaps one of the most intriguing aspects of human Chagas disease is the complex network of events that underlie the generation of protective versus pathogenic immune responses during the chronic phase of the disease. While most individuals do not develop patent disease, a large percentage may develop severe forms that eventually lead to death. Although many efforts have been devoted to deciphering these mechanisms, there is still much to be learned before we can fully understand the pathogenesis of Chagas disease. It is clear that the host's immune response is decisive in this process. While characteristics of the parasite influence the immune response, it is becoming evident that the host genetic background plays a fundamental role in the establishment of pathogenic versus protective responses. The involvement of three complex organisms, host, parasite and vector, is certainly one of the key aspects that calls for multidisciplinary approaches towards the understanding of Chagas disease. We believe that now, one hundred years after the discovery of Chagas disease, it is imperative to continue with highly interactive research in order to elucidate the immune response associated with disease evolution, which will be essential in designing prophylactic or therapeutic interventions.

Immune and inflammatory responses to Leishmania amazonensis isolated from different clinical forms of human leishmaniasis in CBA mice

Leishmania amazonensis causes different diseases depending on the host and parasitic virulence factors. In this study, CBA mice were infected with L. amazonensis isolates from patients with localized (Ba125), diffuse cutaneous (Ba276) or visceral leishmaniasis (Ba109). Mice infected with Ba125 and Ba276 progressed rapidly and lesions displayed an infiltrate rich in parasitized macrophages and were necrotic and ulcerated. Ba109 induced smaller lesions and a mixed inflammatory infiltrate without necrosis or ulceration. Ba109 induced an insidious disease with lower parasite load in CBA mice, similar to human disease. Levels of IFN-γ, IL-4 and IL-10 did not differ among the groups. Because all groups were unable to control the infection, expression of IL-4 associated with low production of IFN-γ in the early phase of infection may account for susceptibility, but others factors may contribute to the differences observed in inflammatory responses and infection progression. Evaluation of some parasitic virulence factors revealed that Ba276 exhibits higher ecto-ADPase and 5'-nucleotidase activities compared to the Ba109 and Ba125 strains. Both Ba276 and Ba125 had higher arginase activity in comparison to Ba109. Finally, these data suggest that the differences in enzyme activities among parasites can account for differences in host inflammatory responses and infection progression.

Prevalence of human papillomavirus infection, distribution of viral types and risk factors in cervical samples from human immunodeficiency virus-positive women attending three human immunodeficiency virus-acquired immune deficiency syndrome reference centres in northeastern Brazil

Human immunodeficiency virus (HIV)-positive patients have a greater prevalence of coinfection with human papillomavirus (HPV) is of high oncogenic risk. Indeed, the presence of the virus favours intraepithelial squamous cell lesion progression and may induce cancer. The aim of this study was to evaluate the prevalence of HPV infection, distribution of HPV types and risk factors among HIV-positive patients. Cervical samples from 450 HIV-positive patients were analysed with regard to oncotic cytology, colposcopy and HPV presence and type by means of polymerase chain reaction and sequencing. The results were analysed by comparing demographic data and data relating to HPV and HIV infection. The prevalence of HPV was 47.5%. Among the HPV-positive samples, 59% included viral types of high oncogenic risk. Multivariate analysis showed an association between HPV infection and the presence of cytological alterations (p = 0.003), age greater than or equal to 35 years (p = 0.002), number of partners greater than three (p = 0.002), CD4+ lymphocyte count < 200/mm3 (p = 0.041) and alcohol abuse (p = 0.004). Although high-risk HPV was present in the majority of the lesions studied, the low frequency of HPV 16 (3.3%), low occurrence of cervical lesions and preserved immunological state in most of the HIV-positive patients were factors that may explain the low occurrence of precancerous cervical lesions in this population.

Genetic variability in G2 and F2 region between biological clones of human respiratory syncytial virus with or without host immune selection pressure

Human respiratory syncytial virus (HRSV) is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn) in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro) in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample.

Antigenic stimulation is more efficient than LPS in inducing nitric oxide production by human mononuclear cells on the in vitro granuloma reaction in schistosomiasis

Nitric oxide (NO) is an extremely important and versatile messenger in biological systems. It has been identified as a cytotoxic factor in the immune system, presenting anti- or pro-inflammatory properties under different circumstances. In murine monocytes and macrophages, stimuli by cytokines or lipopolysaccharide (LPS) are necessary for inducing the immunologic isoform of the enzyme responsible for the high-output production of NO, nitric oxide synthase (iNOS). With respect to human cells, however, LPS seems not to stimulate NO production in the same way. Addressing this issue, we demonstrate here that peripheral blood mononuclear cells (PBMC) obtained from schistosomiasis-infected patients and cultivated with parasite antigens in the in vitro granuloma (IVG) reaction produced more nitrite in the absence of LPS. Thus, LPS-induced nitrite levels are easily detectable, although lower than those detected only with antigenic stimulation. Concomitant addition of LPS and L-N-arginine methyl ester (L-NAME) restored the ability to produce detectable levels of nitrite, which had been lost with L-NAME treatment. In addition, LPS caused a mild decrease of the IVG reaction and its association with L-NAME was responsible for reversal of the L-NAME-exacerbating effect on the IVG reaction. These results show that LPS alone is not as good an NO inducer in human cells as it is in rodent cells or cell lines. Moreover, they provide evidence for interactions between LPS and NO inhibitors that require further investigation.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

CTLA4 enhances the osteogenic differentiation of allogeneic human mesenchymal stem cells in a model of immune activation

Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.

Human cryptosporidiosis: detection of specific antibodies in the serum by an indirect immunofluorescence

Cryptosporidium sp., a coccidian parasite usually found in the faeces of cattle, has been recently implicated as an agent of human intestinal disease, mainly in immunocompromised patients. In the study realized, by an indirect immunofluorescence technique, specific immunoglobulins (IgG and IgM) have been demonstrated in human serum against Cryptosporidium oocysts. Purified oocysts were used as antigens in the indirect immunofluorecence assay. After analyzing this test in sera from selected groups of patients, the frequency of both specific IgG and IgM of immunocompetent children who were excreting oocysts in their faeces was 62% and in children with negative excretion of oocysts was 20% and 40%, respectively. In adults infected with the human immunodeficiency virus (HIV) and who were excreting Cryptosporidium in their stools, the frequency was 57% for IgG but only 2% for IgM. Twenty three percent of immunocompromised adults with not determined excretion of oocysts in their stools had anti-Cryptosporidium IgG in their sera. Children infected with human immunodeficiency virus had no IgM and only 14% had IgG detectable in their sera. The indirect immunoflorescence assay, when used with other parasitological techniques appears to be useful for retrospective population studies and for diagnosis of acute infection. The humoral immune response of HIV positive patients to this protozoan agent needs clarification.

Comparative evaluation of underlying causes of death processed by the Automated Classification of Medical Entities and the Underlying Cause of Death Selection Systems

INTRODUCTION: The correct identification of the underlying cause of death and its precise assignment to a code from the International Classification of Diseases are important issues to achieve accurate and universally comparable mortality statistics These factors, among other ones, led to the development of computer software programs in order to automatically identify the underlying cause of death. OBJECTIVE: This work was conceived to compare the underlying causes of death processed respectively by the Automated Classification of Medical Entities (ACME) and the "Sistema de Seleção de Causa Básica de Morte" (SCB) programs. MATERIAL AND METHOD: The comparative evaluation of the underlying causes of death processed respectively by ACME and SCB systems was performed using the input data file for the ACME system that included deaths which occurred in the State of S. Paulo from June to December 1993, totalling 129,104 records of the corresponding death certificates. The differences between underlying causes selected by ACME and SCB systems verified in the month of June, when considered as SCB errors, were used to correct and improve SCB processing logic and its decision tables. RESULTS: The processing of the underlying causes of death by the ACME and SCB systems resulted in 3,278 differences, that were analysed and ascribed to lack of answer to dialogue boxes during processing, to deaths due to human immunodeficiency virus [HIV] disease for which there was no specific provision in any of the systems, to coding and/or keying errors and to actual problems. The detailed analysis of these latter disclosed that the majority of the underlying causes of death processed by the SCB system were correct and that different interpretations were given to the mortality coding rules by each system, that some particular problems could not be explained with the available documentation and that a smaller proportion of problems were identified as SCB errors. CONCLUSION: These results, disclosing a very low and insignificant number of actual problems, guarantees the use of the version of the SCB system for the Ninth Revision of the International Classification of Diseases and assures the continuity of the work which is being undertaken for the Tenth Revision version.

Immunopathology of human schistosomiasis mansoni: I. Immunomodulatory influences on T cell function

Cell mediated immune response was studied in patients with recent and chronic Schistosoma mansoni infection. Precultured peripheral mononuclear cells showed significantly higher responses to S. mansoni adult worm antigen (SAWA) when compared to fresh cell preparations. The addition of each patient serum to the precultured cells reactions to SAWA or recall antigens demonstrated a strong inhibitory serum action, which was also noted on allogeneic cells derived from healthy subjects. The CD4 subset was the main responding cell to SAWA being this reactivity highly suppressed by the presence of the monocyte macrophage accessory cells. We stressed the simultaneous inhibitory action of humoral and cellular factors on the specific cell response to S. mansoni.

Reduced schedule of human anti rabies immunization with Fuenzalida & Palacios vaccine

The present study evaluates the humoral and cellular immune responses in 35 volunteers submited to short antirabies vaccination schedules with the Fuenzalida & Palacios vaccine based on the administration of doses on non consecutive days. The volunteers were divided into two groups. The first group received a total number of five doses given on days 0, 4, 7, 20 and 35. The other group received four doses, the first one being a double dose given on day 0 and than three other single doses on days 7, 20 and 35. The evaluation of humoral immune response was carried out by serum neutralization (SN) and indirect immunofluorescense (IIF) tests, while the cellular immune response was evaluated by lymphoblastic transformation assay (LTA) and skin test (ST). According to our results these reduced schedules elicited early and effective humoral and cellulafimmune responses to rabies antigen suggesting that new reduced schedules should be extensively studied in order to give the proper bases to the proposition of changes in the current long-term schedule.

Reduced schedule of human anti-rabies immunization with Fuenzalida & Palacios vaccine: additional data

It was reevaluated a reduced schedule for anti-rabies post-exposure immunization with newborn mice nervous tissue vaccine (Fuenzalida 8c Palacios) in a group of 30 non exposed volunteers. The vaccine was administered by intramuscular injections on days zero, 2, 4, 16 and 27, in the deltoid area. Antibody levels were determinated by a simplified serum neutralization microtest on days zero, 16 and 37. On days 16 and 37 the antibody levels of the whole group was >0.5 IU/ml and >1.0 IU/ml, respectively. The cell mediated immunity was precociously detected (on day 4) by the delayed type hipersensitivity skin test. Our results show that this reduced schedule elicited an early and effective humoral and cellular immune response. However it is necessary other studies with larger groups of vaccinees in order to obtain definitive conclusion.

Detection of Toxoplasma gondii soluble antigen, SAG-1(p30), antibody and immune complex in the cerebrospinal fluid of HIV positive or negative individuals

Active infection by T. gondii was evaluated by immunoassay for soluble SAG-1 (p30), the major surface antigen from T. gondii, specific antibodies and immune complexes in human cerebrospinal fluid (CSF) samples. A total of 263 samples of CSF were collected from hospitalized patients presenting neurological disorders and analyzed for antibodies to HIV. Patients were divided into two groups: HIV positive (n = 96) or HIV negative (n =167). The results of the assays showed that 45% of all samples were positive for soluble SAG-1. Toxoplasma Ag/Ab immune complexes were detected in 19% of the CSF samples and 62% were positive for T. gondii- specific IgG. A combination of these assays in the presence of clinical findings consistent with active Toxoplasma infection may predict the presence of toxoplasmic encephalitis. Moreover, detection of soluble SAG-1 in the CSF of these individuals appears consistent with active infection.

Proposal of abolition of the skin sensitivity test before equine rabies immune globulin application

An epizootic outbreak of rabies occurred in 1995 in Ribeirão Preto, SP, with 58 cases of animal rabies (54 dogs, 3 cats and 1 bat) confirmed by the Pasteur Institute of São Paulo, and one human death. The need to provide care to a large number of people for the application of equine rabies immune globulin (ERIG) prevented the execution of the skin sensitivity test (SST) and often also the execution of desensitization, procedures routinely used up to that time at the Emergency Unit of the University Hospital of the Faculty of Medicine of Ribeirão Preto, University of São Paulo (EU-UHFMRP-USP), a reference hospital for the application of heterologous sera. In view of our positive experience of several years with the abolition of SST and of the use of premedication before the application of antivenom sera, we used a similar schedule for ERIG application. Of the 1489 victims of animal bites, 1054 (71%) received ERIG; no patient was submitted to SST and all received intravenously anti-histamines (anti-H1 + anti-H2) and corticosteroids before the procedure. The patients were kept under observation for 60 to 180 minutes and no adverse reaction was observed. On the basis of these results, since December 1995 ERIG application has been decentralized in Ribeirão Preto and has become the responsibility of the Emergency Unit of the University Hospital and the Central Basic Health Unit, where the same routine is used. Since then, 4216 patients have received ERIG (1818 at the Basic Health Unit and 2398 at the EU-UHFMRP), with no problems. The ideal would be the routine use of human rabies immune globulin (HRIG) in public health programs, but this is problematic, because of their high cost. However, while this does not occur, the use of SST is no longer justified at the time of application of ERIG, in view of the clinical evidence of low predictive value and low sensitivity of SST involving the application of heterologous sera. It is very important to point out that a negative SST result may lead the health team to a feeling of false safety that no adverse reaction will occur, but this is not true for the anaphylactoid reactions. The decision to use premedication, which is based on knowledge about anaphylaxis and on the pharmacology of the medication used, is left to the judgment of health professionals, who should always be prepared for eventual untoward events.

Heterologous antigen extract in ELISA for the detection of human IgE anti-Strongyloides stercoralis

Strongyloides ratti larval extract was used for the standardization of ELISA to detect genus-specific IgE in human strongyloidiasis. Forty serum samples from monoinfected patients shedding S. stercoralis larvae (Group I), 40 from patients with other intestinal parasites (Group II), and 40 from copronegative healthy subjects (Group III) were analyzed. Genus-specific IgE levels (ELISA Index: EI) were significantly higher in the group I (EI = 1.43) than groups II (EI = 0.70) and III (EI = 0.71), showing positivity rates of 55%, 2.5% and 0%, respectively. Similarly, sera from copropositive patients had significantly higher levels of total IgE (866 IU/mL) as compared to those from group II (302 IU/mL) and III (143 IU/mL). A significant positive correlation was found between levels of Strongyloides specific-IgE and total IgE in sera from patients with strongyloidiasis. In conclusion, S. ratti heterologous extract showed to be a useful tool for detecting genus-specific IgE by ELISA, contributing for a better characterization of the immune response profile in human strongyloidiasis.