Response of the growth plate of uremic rats to human growth hormone and corticosteroids

Children with chronic renal failure in general present growth retardation that is aggravated by corticosteroids. We describe here the effects of methylprednisolone (MP) and recombinant human growth hormone (rhGH) on the growth plate (GP) of uremic rats. Uremia was induced by subtotal nephrectomy in 30-day-old rats, followed by 20 IU kg-1 day-1 rhGH (N = 7) or 3 mg kg-1 day-1 MP (N = 7) or 20 IU kg-1 day-1 rhGH + 3 mg kg-1 day-1 MP (N = 7) treatment for 10 days. Control rats with intact renal function were sham-operated and treated with 3 mg kg-1 day-1 MP (N = 7) or vehicle (N = 7). Uremic rats (N = 7) were used as untreated control animals. Structural alterations in the GP and the expression of anti-proliferating cell nuclear antigen (PCNA) and anti-insulin-like growth factor I (IGF-I) by epiphyseal chondrocytes were evaluated. Uremic MP rats displayed a reduction in the proliferative zone height (59.08 ± 4.54 vs 68.07 ± 7.5 µm, P < 0.05) and modifications in the microarchitecture of the GP. MP and uremia had an additive inhibitory effect on the proliferative activity of GP chondrocytes, lowering the expression of PCNA (19.48 ± 11.13 vs 68.64 ± 7.9% in control, P < 0.0005) and IGF-I (58.53 ± 0.96 vs 84.78 ± 2.93% in control, P < 0.0001), that was counteracted by rhGH. These findings suggest that in uremic rats rhGH therapy improves longitudinal growth by increasing IGF-I synthesis in the GP and by stimulating chondrocyte proliferation.

Human papillomavirus infection and its association with cervical dysplasia in Ecuadorian women attending a private cancer screening clinic

Women living in Latin American countries bear a disproportionate burden of cervical cancer, a condition caused by infection with the human papillomavirus (HPV). We performed a study in Santa Elena, Guayas (currently Santa Elena Province), Ecuador, to determine how often HPV could be detected in women attending a private cancer screening clinic. Participants underwent a Pap test, and vaginal and cervical swabs were performed for HPV testing by the polymerase chain reaction (PCR). Each participant completed a verbally administered survey. The mean age of 302 participants was 37.7 years (range 18 to 78 years). The majority of cervical and vaginal specimens contained sufficient DNA to perform PCR. Overall, 24.2% of the participants had either a cervical or vaginal swab that tested positive for HPV. In general, there was a good correlation between the HPV types detected in the cervical and vaginal swabs from the participants, but vaginal swabs were more likely to contain HPV DNA than were cervical swabs. The high-risk HPV types 16, 52, 58, and 59 and the low-risk HPV types 62, 71, 72, and 83 were the most frequently detected HPV types. The number of lifetime sexual partners was positively associated with detection of any HPV type, detection of oncogenic HPV, and abnormal Pap smears. Further studies are needed to determine if these results are representative of all Ecuadorian women and to determine if cervical cancers in Ecuadorian women are caused by the same HPV types found in the swab specimens obtained in this study.

Human papillomavirus detection and p16 methylation pattern in a case of esophageal papilloma

Esophageal cancer is a prevalent cancer worldwide. Some studies have reported the possible etiology of human papillomavirus (HPV) in benign and malignant papillomas of the esophagus but the conclusions are controversial. In the present study, we investigated an esophageal papilloma from a 30-year-old male patient presenting aphasia. HPV DNA was detected by generic PCR using MY09/11 primers, and restriction fragment length polymorphism revealed the presence of HPV54, usually associated with benign genital lesions. Hypermethylation of the pINK4A gene was also investigated due to its relation to malignant transformation, but no modification was detected in the host gene. Except for an incipient reflux, no risk factors such as cigarette smoking, alcohol abuse or an infected sexual partner were recorded. Since esophageal lesions may have a malignant potential, HPV detection and typing are useful tools for patient follow-up.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Serological and parasitological study and report of the first case of human babesiosis in Colombia

A study on the presence of Babesia in humans was performed in Puerto Berrío (Latitude 6.50deg. Longitude: -74.38deg. River: Magdalena. Area: 74.410km², Colombia-South America). Indirect immunofluorescence, thin and thick blood smears were used to study 194 individuals. Patients were grouped according to their risk-factors for Babesia infection: (group 1) individuals with fever, chills, sweating and other malaria-type symptoms; (group 2) symptomatic and asymptomatic individuals from local cattle ranches, which were enrolled in an active form, and (group 3) workers from the local slaughterhouse. Seven individuals were serologically positive for Babesia: Three individuals presented IgM antibodies against B. bovis, while one had IgG against this species; one individual had IgM against B. bigemina, another had IgG and a third both IgM and IgG against this species. Only one individual was parasitologically positive for Babesiaand serologically positive for Babesia bovis (IgM 1:64)

Low prevalence of hepatitis B virus, hepatitis D virus and hepatitis C virus among patients with human immunodeficiency virus or acquired immunodeficiency syndrome in the Brazilian Amazon basin

Comorbidities in human immunodeficiency virus infection are of great interest due to their association with unfavorable outcomes and failure of antiretroviral therapy. This study evaluated the prevalence of coinfection by human immunodeficiency virus and viral hepatitis in an endemic area for hepatitis B in the Western Amazon basin. Serological markers for hepatitis B virus, hepatitis C virus and hepatitis D virus were tested in a consecutive sample of all patients referred for treatment of human immunodeficiency virus or acquired immunodeficiency syndrome. The variables sex, age, origin and exposure category were obtained from medical records and from the sexually transmitted diseases and acquired immunodeficiency syndrome surveillance database. Among 704 subjects, the prevalence of chronic hepatitis B carriage was 6.4% and past infection 40.2%. The presence of hepatitis B was associated with birth in hyperendemic areas of the Amazon basin, male sex and illegal drug use. The overall prevalence of hepatitis C was 5% and was associated with illegal drug use. The prevalence of hepatitis B and C among human immunodeficiency virus or acquired immunodeficiency syndrome patients in the Western Amazon basin was lower than seen elsewhere and is probably associated with the local epidemiology of these viruses and the degree of overlap of their shared risk factors. An opportunity presents itself to evaluate the prevention of hepatitis C through harm reduction policies and hepatitis B through vaccination programs among human immunodeficiency virus or acquired immunodeficiency syndrome patients.

Viral diseases and human evolution

The interaction of man with viral agents was possibly a key factor shaping human evolution, culture and civilization from its outset. Evidence of the effect of disease, since the early stages of human speciation, through pre-historical times to the present suggest that the types of viruses associated with man changed in time. As human populations progressed technologically, they grew in numbers and density. As a consequence different viruses found suitable conditions to thrive and establish long-lasting associations with man. Although not all viral agents cause disease and some may in fact be considered beneficial, the present situation of overpopulation, poverty and ecological inbalance may have devastating effets on human progress. Recently emerged diseases causing massive pandemics (eg., HIV-1 and HCV, dengue, etc.) are becoming formidable challenges, which may have a direct impact on the fate of our species.

The importance of Anopheles albitarsis E and An. darlingi in human malaria transmission in Boa Vista, state of Roraima, Brazil

In several districts of Boa Vista, state of Roraima, Brazil we found Anopheles (Nyssorhynchus) albitarsis E to be the primary vector of human malaria parasites, and during 2001-2002 it was significantly more abundant than An. darlingi (p < 0.001). Other species sampled were An. (Nys.) braziliensis, An. (Ano.) peryassui, An. (Nys.) nuneztovari, An. (Nys.) oswaldoi s.l., and An. (Nys.) triannulatus. As determined by the ELISA technique An. darlingi had a higher overall infection rate (2.1%) compared with An. albitarsis E (1.2%). However, a marginally higher proportion of An. albitarsis E was infected with Plasmodium vivax compared with An. darlingi, and the An. albitarsis E biting index was also much higher. These results suggest the importance of An. albitarsis E in malaria transmission in a savannah ecoregion of northern Amazonian Brazil, and reconfirm the importance of An. darlingi even if at lower abundance.

Frequency and types of human papillomavirus among pregnant and non-pregnant women with human immunodeficiency virus infection in Recife determined by genotyping

Women with human immunodeficiency virus (HIV) infection present a higher risk of infection by the human papillomavirus (HPV) and cervical cancer. To determine HPV genotypes and frequencies among HIV-positive women, an analytical cross-sectional study was carried out on 147 women (51 were pregnant and HIV-positive, 45 pregnant and HIV-negative and 51 HIV-positive and not pregnant), who were attended at a maternity hospital in Recife between April 2006-May 2007. They answered a questionnaire and underwent a gynaecological examination, with samples collected for HPV investigation by PCR, hybrid capture II, oncotic colpocytology (Papanicolau) and colposcopy. The frequency of HPV DNA was 85.3% (122/143), with a high proportion of HPV types that have been identified as high risk for cervical cancer. Among HIV-positive pregnant women, there was an HPV prevalence of 96% (48/50), of whom 60.4% (29/48) were high-risk. HPV 16, 58, 18, 66 and 31 were the most frequent types. Colpocytological abnormalities were observed in 35.3% (18/51) of HIV-positive non-pregnant women, 21.6% (11/51) of HIV-positive pregnant women and 13.3% (6/45) of HIV-negative pregnant women with a predominance of low-level lesions. A high prevalence of HPV infection was identified, especially with the high-risk types 16, 58, 18 and 66. This study identified high-risk HPV types in all three groups examined (HIV-positive pregnant women, HIV-negative pregnant women and HIV-positive not pregnant), characterising its distribution in this setting.

Evaluation of HA negatively charged membranes in the recovery of human adenoviruses and hepatitis A virus in different water matrices

Human adenoviruses (HAdV) and hepatitis A virus (HAV) are shed in the faeces and consequently may be present in environmental waters, resulting in an increase in pathogen concentration that can affect water quality and human health. The aim of this study was to evaluate an adsorption-elution method which utilizes negatively charged membrane HA to determine the efficient recovery of HAdV and HAV from different water matrices and to combine this procedure with a qualitative molecular method (nested RT-PCR and nested PCR). The best efficiency recovery was achieved in distilled water and treated wastewater effluent (100%) for both viruses and in recreational lagoon water for HAV (100%). The efficiency recovery was 10% for HAdV and HAV in seawater and 10% for HAdV in lagoon water. The viral detection limit by nested PCR for HAV in water samples ranged between 20-0.2 FFU/mL and 250 and 25 TCID50/mL for HAdV. In conclusion, these results suggest that the HA negatively charged membranes vary their efficiency for recovery of viral concentration depending upon the types of both enteric viruses and water matrices.

Detection of human bocavirus and human metapneumovirus by real-time PCR from patients with respiratory symptoms in Southern Brazil

The introduction of newer molecular methods has led to the discovery of new respiratory viruses, such as human metapneumovirus (hMPV) and human bocavirus (hBoV), in respiratory tract specimens. We have studied the occurrence of hMPV and hBoV in the Porto Alegre (PA) metropolitan area, one of the southernmost cities of Brazil, evaluating children with suspected lower respiratory tract infection from May 2007-June 2008. A real-time polymerase chain reaction method was used for amplification and detection of hMPV and hBoV and to evaluate coinfections with respiratory syncytial virus (RSV), influenza A and B, parainfluenza 1, 2 and 3, human rhinovirus and human adenovirus. Of the 455 nasopharyngeal aspirates tested, hMPV was detected in 14.5% of samples and hBoV in 13.2%. A unique causative viral agent was identified in 46.2% samples and the coinfection rate was 43.7%. For hBoV, 98.3% of all positive samples were from patients with mixed infections. Similarly, 84.8% of all hMPV-positive results were also observed in mixed infections. Both hBoV and hMPV usually appeared with RSV. In summary, this is the first confirmation that hMPV and hBoV circulate in PA; this provides evidence of frequent involvement of both viruses in children with clinical signs of acute viral respiratory tract infection, although they mainly appeared as coinfection agents.

UV determination of epinephrine, uric acid, and acetaminophen in pharmaceutical formulations and some human body fluids using multivariate calibration

In this work, a spectrophotometric methodology was applied in order to determine epinephrine (EP), uric acid (UA), and acetaminophen (AC) in pharmaceutical formulations and spiked human serum, plasma, and urine by using a multivariate approach. Multivariate calibration methods such as partial least squares (PLS) methods and its derivates were used to obtain a model for simultaneous determination of EP, UA and AC with good figures of merit and mixture design was in the range of 1.8 - 35.3, 1.7 - 16.8, and 1.5 - 12.1 µg mL-1. The 2nd derivate PLS showed recoveries of 95.3 - 103.3, 93.3 - 104.0, and 94.0 - 105.5 µg mL-1 for EP, UA, and AC, respectively.

Spectrophotometric determination of ofloxacin in pharmaceuticals and human urine

Three simple and sensitive spectrophotometric methods are described for the determination of ofloxacin (OFX) in pharmaceuticals and in spiked human urine. First and second methods are based on the measurement of absorbance of OFX in 0.1 M HCl at 293 nm (method A) and 0.1 M NaOH at 287 nm, respectively. The third method is based on the measurement of 2:1 complex formed between OFX and iron(III) in H2SO4 medium, the complex peaking at 420 nm (method C). The optimum conditions for all the three methods are optimized. Beer's law is obeyed over the ranges 0.63-12.5 using method A and method B, and 10-120 µg mL-1 using method C. The apparent molar absorptivity values are calculated to be 3.5 × 10(4), 2.76 × 10(4) and 2.51 × 10³ L mol-1cm-1 for method A, method B and method C, respectively. The Sandell sensitivity, limit of detection (LOD) and limit quantification (LOQ) values are also reported. All the methods were validated in accordance with current ICH guidelines. The developed methods were employed with high degree of precision and accuracy for the estimation of total drug content in commercial tablet formulations of DOX. The results obtained from human spiked urine are satisfactory and recovery values are in the range 95.5-106.6%.

Cytokines as determinants of resistance and pathology in human Schistosoma mansoni infection

The role of different cytokines in the peripheral blood mononuclear cell (PBMC) proliferative response and in in vitro granuloma formation was evaluated in a cross-sectional study with patients with the different clinical forms and phases of Schistosoma mansoni infection, as well as a group of individuals "naturally" resistant to infection named normal endemic (NE). The blockage of IL-4 and IL-5 using anti-IL-4 and anti-IL-5 antibodies significantly reduced the PBMC proliferative response to soluble egg (SEA) and adult worm (SWAP) antigens in acute (ACT), chronic intestinal (INT) and hepatosplenic (HS) patients. Similar results were obtained in the in vitro granuloma formation. Blockage of IL-10 had no significant effect on either assay using PBMC from ACT or HS. In contrast, the addition of anti-IL-10 antibodies to PBMC cultures from INT patients significantly increased the proliferative response to SEA and SWAP as well as the in vitro granuloma formation. Interestingly, association of anti-IL-4 and anti-IL-10 antibodies did not increase the PBMC proliferative response of these patients, suggesting that IL-10 may act by modulating IL-4 and IL-5 secretion. Addition of recombinant IL-10 decreased the proliferative response to undetectable levels when PBMC from patients with the different clinical forms were used. Analysis of IFN-g in the supernatants showed that PBMC from INT patients secreted low levels of IFN-g upon antigenic stimulation. In contrast, PBMC from NE secreted high levels of IFN-g. These data suggest that IL-10 is an important cytokine in regulating the immune response and possibly controlling morbidity in human schistosomiasis mansoni, and that the production of IFN-g may be associated with resistance to infection.

Estrogen and progesterone receptors in human papilloma virus-related cervical neoplasia

Estrogen (ER) and progesterone (PR) receptors in the normal uterine cervix, cervical intraepithelial neoplasia and invasive carcinoma were studied in consecutive samples from Hospital do Câncer, São Paulo, between 1996 and 1997. Tissue was collected by removing a fragment of the tumoral area using a 5-mm diameter biopsy punch, followed by removal of a macroscopically normal area as close as possible from the tumor. Histopathological confirmation was obtained for all specimens analyzed. A total of 24 normal tissues, 17 cases of cervical intraepithelial neoplasia and 7 of invasive carcinomas were studied. The ER/PR ratio was determined by immunohistochemistry using monoclonal antibodies specific for each receptor. Adjacent tissue slides were submitted to generic PCR for human papillomavirus (HPV) DNA detection followed by typing by dot blot hybridization. About half (45.8%) of the tumors were HPV DNA positive while 29.1% of the patients were also HPV positive in their respective normal tissue. ER was negative in the tumoral epithelium of 11 HPV-positive patients (P = 0.04). There was a trend in the ER distribution in normal tissue that was opposite to that from lesions, but it was not statistically significant (P = 0.069). No difference in ER distribution in stromal tissues was observed between HPV-positive and HPV-negative tissues. PR staining was negative in the epithelium of all cases studied. The results obtained from this small number of cases cannot be considered to be conclusive but do suggest that factors related to viral infection affect the expression of these ER/PR cervix receptors.