Serum cytokine levels in autoimmune and non-autoimmune hyperthyroid states

Although the role of interleukin-2 (IL-2) and interferon gamma (gIFN) is still poorly understood in hyperthyroid diseases, it is reasonable to assume that these cytokines may be present at higher levels in Graves' disease (GD) than in other primarily non-autoimmune thyroid diseases. In order to look for an easy method to distinguish GD from primarily non-autoimmune causes of hyperthyroidism, we compared 13 healthy individuals with 21 treated and untreated hyperthyroid GD patients and with 19 patients with hyperthyroidism due to other etiologies: 7 cases of multinodular goiter, 5 cases of excessive hormone replacement and 7 cases of amiodarone-associated hyperthyroidism. All patients presented low TSH levels and a dubious clinical thyroid state. We found a good correlation between TSH and serum IL-2 levels (r = 0.56; P<0.01). Serum IL-2 (P<0.01) and gIFN (P<0.01) levels were lower in the hyperthyroid group of patients than in control subjects, suggesting a depressed TH1 pattern in the T-cell subset of hyperthyroid patients. GD had normal IL-2 levels, while patients with other forms of thyrotoxicosis presented decreased IL-2 levels (P<0.05). There was no difference between treated and untreated GD patients. We suggest that the direct measurement of serum IL-2 level may help to confirm hyperthyroidism caused by GD.

The Agamma-195 (C->G) mutation in hereditary persistence of fetal hemoglobin is not associated with activation of a reporter gene in vitro

Hereditary persistence of fetal hemoglobin is an uncommon, benign disorder in which the expression of gamma-globin genes persists into adult life. Several point mutations have been associated with the increased gamma-globin gene promoter activity. We evaluated the -195 (C->G) mutation by a functional in vitro assay based on the luciferase reporter gene system. The results indicated that the increased promoter activity observed in vivo could not be reproduced in vitro under the conditions employed, suggesting that other factors may be involved in the overexpression of the gamma-globin gene containing the -195 (C->G) mutation. Furthermore, this is the first time that the -195 (C->G) mutation of the Agamma-globin gene has been evaluated by in vitro gene expression.

Effects of 60Co gamma radiation on crotamine

Ionizing radiation can change the molecular structure and affect the biological properties of biomolecules. This has been employed to attenuate animal toxins. Crotamine is a strongly basic polypeptide (pI 10.3) from Crotalus durissus terrificus venom composed of 42 amino acid residues. It induces skeletal muscle spasms leading to a spastic paralysis of hind limbs in mice. The objective of the present study was to carry out a biochemical study and a toxic activity assay on native and irradiated crotamine. Crotamine was purified from C.d. terrificus venom by Sephadex G-100 gel filtration followed by ion-exchange chromatography, and irradiated at 2 mg/ml in 0.15 M NaCl with 2.0 kGy gamma radiation emitted by a 60Co source. The native and irradiated toxins were evaluated in terms of structure and toxic activity (LD50). Irradiation did not change the protein concentration, the electrophoretic profile or the primary structure of the protein although differences were shown by spectroscopic techniques. Gamma radiation reduced crotamine toxicity by 48.3%, but did not eliminate it.

Kinetics of TNF-alpha and IFN-gamma mRNA expression in islets and spleen of NOD mice

Insulin-dependent diabetes mellitus is caused by autoimmune destruction of pancreatic ß cells. Non-obese diabetic (NOD) mice spontaneously develop diabetes similar to the human disease. Cytokines produced by islet-infiltrating mononuclear cells may be directly cytotoxic and can be involved in islet destruction coordinated by CD4+ and CD8+ cells. We utilized a semiquantitative RT-PCR assay to analyze in vitro the mRNA expression of TNF-alpha and IFN-gamma cytokine genes in isolated islets (N = 100) and spleen cells (5 x 10(5) cells) from female NOD mice during the development of diabetes and from female CBA-j mice as a related control strain that does not develop diabetes. Cytokine mRNAs were measured at 2, 4, 8, 14 and 28 weeks of age from the onset of insulitis to the development of overt diabetes. An increase in IFN-gamma expression in islets was observed for females aged 28 weeks (149 ± 29 arbitrary units (AU), P<0.05, Student t-test) with advanced destructive insulitis when compared with CBA-j mice, while TNF-alpha was expressed in both NOD and CBA-j female islets at the same level at all ages studied. In contrast, TNF-alpha in spleen was expressed at higher levels in NOD females at 14 weeks (99 ± 8 AU, P<0.05) and 28 weeks (144 ± 17 AU, P<0.05) of age when compared to CBA-j mice. The data suggest that IFN-gamma and TNF-alpha expression in pancreatic islets of female NOD mice is associated with ß cell destruction and overt diabetes.

Effect of bullfrog (Rana catesbeiana) oil administered by gavage on the fatty acid composition and oxidative stress of mouse liver

The aim of the present study was to investigate the effects of daily intragastric administration of bullfrog oil (oleic, linoleic and palmitoleic acid-rich oil), corresponding to 0.4% of body weight for four weeks, on fatty acid composition and oxidative stress (lipid peroxidation and catalase activity) in mouse liver. The activities of aspartate aminotransferase (AST), alkaline phosphatase (ALP), alanine aminotransferase (ALT), and gamma-glutamyltransferase (GGT), biomarkers of tissue injury, were determined in liver homogenates and serum. The proportions of 18:2n-6, 20:4n-6, 20:5n-3, and 22:6n-3 (polyunsaturated fatty acids, from 37 to 60%) in the total fatty acid content were increased in the liver of the bullfrog oil-treated group (P < 0.05) compared to control. At the same time, a significant decrease in the relative abundance of 14:0, 16:0, and 18:0 (saturated fatty acids, from 49 to 25%) was observed. The hepatic content of thiobarbituric acid reactive substances (TBARS) was increased from 2.3 ± 0.2 to 12.3 ± 0.3 nmol TBA-MDA/mg protein and catalase activity was increased from 840 ± 32 to 1110 ± 45 µmol reduced H2O2 min-1 mg protein-1 in the treated group. Bullfrog oil administration increased AST and ALP activities in the liver (from 234.10 ± 0.12 to 342.84 ± 0.13 and 9.38 ± 0.60 to 20.06 ± 0.27 U/g, respectively) and in serum (from 95.41 ± 6.13 to 120.32 ± 3.15 and 234.75 ± 11.5 to 254.41 ± 2.73 U/l, respectively), suggesting that this treatment induced tissue damage. ALT activity was increased from 287.28 ± 0.29 to 315.98 ± 0.34 U/g in the liver but remained unchanged in serum, whereas the GGT activity was not affected by bullfrog oil treatment. Therefore, despite the interesting modulation of fatty acids by bullfrog oil, a possible therapeutic use requires care since some adverse effects were observed in liver.

The role of IFN-gamma and IL-4 in gastric mucosa inflammation associated with Helicobacter heilmannii type 1 infection

Although Helicobacter heilmannii infection is less common than H. pylori infection in humans, it is considered to be of medical importance because of its association with gastritis, gastric ulcer, carcinoma, and mucosa-associated lymphoid tissue lymphoma of the stomach. However, there have been no studies evaluating the role of the Th cell response in H. heilmannii gastric infection. We evaluated the participation of pro-inflammatory and anti-inflammatory cytokines, IFN-gamma and IL-4, in H. heilmannii gastric infection in genetically IFN-gamma- or IL-4-deficient mice. The serum IFN-gamma and IL-4 concentrations were determined by ELISA. The gastric polymorphonuclear infiltrate was higher (P = 0.007) in H. heilmannii-positive than in H. heilmannii-negative wild-type (WT) C57BL/6 mice, whereas no significant inflammation was demonstrable in the stomach of H. heilmannii-positive IFN-gamma-/- C57BL/6 mice. The degree of gastric inflammatory cells, especially in oxyntic mucosa, was also higher (P = 0.007) in infected IL-4-/- than in WT BALB/c mice. Serum IFN-gamma levels were significantly higher in IL-4-/- than in WT BALB/c mice, independently of H. heilmannii-positive or -negative status. Although no difference in serum IFN-gamma levels was seen between H. heilmannii-positive (11.3 ± 3.07 pg/mL, mean ± SD) and -negative (11.07 ± 3.5 pg/mL) WT BALB/c mice, in the group of IL-4-/- animals, the serum concentration of IFN-g was significantly higher in the infected ones (38.16 ± 10.5 pg/mL, P = 0.04). In contrast, serum IL-4 levels were significantly decreased in H. heilmannii-positive (N = 10) WT BALB/c animals compared to the negative (N = 10) animals. In conclusion, H. heilmannii infection induces a predominantly Th1 immune response, with IFN-gamma playing a central role in gastric inflammation.

Effects of 174 G/C polymorphism in the promoter region of the interleukin-6 gene on plasma IL-6 levels and muscle strength in elderly women

We investigated the effect of -174 G/C single-nucleotide polymorphism in the promoter region of the IL6 gene on plasma IL-6 levels and muscle strength, and the relationship between IL-6 levels and muscle strength in elderly women. The sample consisted of 199 elderly residents (73.0 ± 7.8 years old) from rest homes and the community in Belo Horizonte, MG, Brazil. -174 G/C polymorphism was determined by direct sequencing of the product by PCR, and plasma IL-6 concentrations were measured by ELISA. Muscle strength in the knee joint was evaluated using a Biodex System 3 Pro® isokinetic dynamometer. ANCOVA was used to determine the effect of polymorphism on IL-6 levels and muscle strength, and the Pearson correlation coefficient to assess the relationship between IL-6 levels and muscle strength. -174 G/C polymorphism was associated with the plasma IL-6 levels of elderly women (P < 0.01) since homozygotes for the G allele showed high IL-6 levels (GG 3.85 pg/mL, GC + CC 2.13 pg/mL). There was no association of polymorphism on muscle strength (P &gt; 0.05). No association was found between IL-6 levels and knee extensor muscle (r = 0.087, P = 0.306) or flexor (r = -0.011, P = 0.894) strength. An interaction between -174 G/C polymorphism and housing conditions of the sample of elderly women was identified, with the effect of genotype on IL-6 levels being higher in the institutionalized elderly. These results support the evidence that -174 G/C polymorphism of the IL6 gene associates with individual variability of plasma IL-6 levels in elderly women.

Interleukin-10-dependent down-regulation of interferon-gamma response to Leishmania by Mycobacterium leprae antigens during the clinical course of a coinfection

We have described a case of a patient with an intriguing association of mucocutaneous leishmaniasis with lepromatous leprosy, two opposite polar forms of these spectral diseases. In the present follow-up study, we investigated the effect of the addition of Mycobacterium leprae antigens on interferon-gamma (IFN-γ) production in Leishmania antigen-stimulated cultures of peripheral blood mononuclear cells (PBMC) from this patient. For this purpose, PBMC cultures were stimulated with crude L. braziliensis and/or M. leprae whole-cell antigen extracts or with concanavalin A. In some experiments, neutralizing anti-human interleukin (IL)-10 antibodies were added to the cultures. IFN-γ and IL-10 levels in culture supernatants were measured by ELISA. During active leprosy, M. leprae antigens induced 72.3% suppression of the IFN-γ response to L. braziliensis antigen, and this suppression was abolished by IL-10 neutralization. Interestingly, the suppressive effect of M. leprae antigen was lost after the cure of leprosy and the disappearance of this effect was accompanied by exacerbation of mucosal leishmaniasis. Considered together, these results provide evidence that the concomitant lepromatous leprosy induced an IL-10-mediated regulatory response that controlled the immunopathology of mucosal leishmaniasis, demonstrating that, in the context of this coinfection, the specific immune response to one pathogen can influence the immune response to the other pathogen and the clinical course of the disease caused by it. Our findings may contribute to a better understanding of the Leishmania/M. leprae coinfection and of the immunopathogenesis of mucosal leishmaniasis.

Plasmatic ADAMTS-13 metalloprotease and von Willebrand factor in children with cyanotic congenital heart disease

Changes in plasma von Willebrand factor concentration (VWF:Ag) and ADAMTS-13 activity (the metalloprotease that cleaves VWF physiologically) have been reported in several cardiovascular disorders with prognostic implications. We therefore determined the level of these proteins in the plasma of children with cyanotic congenital heart disease (CCHD) undergoing surgical treatment. Forty-eight children were enrolled (age 0.83 to 7.58 years). Measurements were performed at baseline and 48 h after surgery. ELISA, collagen-binding assays and Western blotting were used to estimate antigenic and biological activities, and proteolysis of VWF multimers. Preoperatively, VWF:Ag and ADAMTS-13 activity were decreased (65 and 71% of normal levels considered as 113 (105-129) U/dL and 91 ± 24% respectively, P < 0.003) and correlated (r = 0.39, P = 0.0064). High molecular weight VWF multimers were not related, suggesting an interaction of VWF with cell membranes, followed by proteolytic cleavage. A low preoperative ADAMTS-13 activity, a longer activated partial thromboplastin time and the need for cardiopulmonary bypass correlated with postoperative bleeding (P < 0.05). Postoperatively, ADAMTS-13 activity increased but less extensively than VWF:Ag (respectively, 2.23 and 2.83 times baseline, P < 0.0001), resulting in an increased VWF:Ag/ADAMTS-13 activity ratio (1.20 to 1.54, respectively, pre- and postoperative median values, P = 0.0029). ADAMTS-13 consumption was further confirmed by decreased ADAMTS-13 antigenic concentration (0.91 ± 0.30 to 0.70 ± 0.25 µg/mL, P < 0.0001) and persistent proteolysis of VWF multimers. We conclude that, in pediatric CCHD, changes in circulating ADAMTS-13 suggest enzyme consumption, associated with abnormal structure and function of VWF.

Tumor growth reduction is regulated at the gene level in Walker 256 tumor-bearing rats supplemented with fish oil rich in EPA and DHA

We investigated the effect of fish oil (FO) supplementation on tumor growth, cyclooxygenase 2 (COX-2), peroxisome proliferator-activated receptor gamma (PPARγ), and RelA gene and protein expression in Walker 256 tumor-bearing rats. Male Wistar rats (70 days old) were fed with regular chow (group W) or chow supplemented with 1 g/kg body weight FO daily (group WFO) until they reached 100 days of age. Both groups were then inoculated with a suspension of Walker 256 ascitic tumor cells (3×107 cells/mL). After 14 days the rats were killed, total RNA was isolated from the tumor tissue, and relative mRNA expression was measured using the 2-ΔΔCT method. FO significantly decreased tumor growth (W=13.18±1.58 vsWFO=5.40±0.88 g, P<0.05). FO supplementation also resulted in a significant decrease in COX-2 (W=100.1±1.62 vsWFO=59.39±5.53, P<0.001) and PPARγ (W=100.4±1.04vs WFO=88.22±1.46, P<0.05) protein expression. Relative mRNA expression was W=1.06±0.022 vsWFO=0.31±0.04 (P<0.001) for COX-2, W=1.08±0.02vs WFO=0.52±0.08 (P<0.001) for PPARγ, and W=1.04±0.02 vs WFO=0.82±0.04 (P<0.05) for RelA. FO reduced tumor growth by attenuating inflammatory gene expression associated with carcinogenesis.

Association between the c.910A&gt;G genetic variant of the XRCC1 gene and susceptibility to esophageal cancer in the Chinese Han population

Esophageal cancer (EC) is a common malignancy worldwide. The X-ray repair cross-complementing 1 gene (XRCC1) is one of the most important candidate genes for influencing susceptibility to EC. This study aimed to investigate the effect of XRCC1 genetic variants on susceptibility to EC. A total of 383 EC patients (males: 239, females: 144, mean age: 56.62) and 387 cancer-free controls (males: 251, females: 136, mean age: 58.23) were enrolled in this study. The c.910A>G genetic variant of theXRCC1 gene was determined by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing methods. The allele and genotype frequencies indicated statistical differences between EC patients and cancer-free controls. The c.910A>G genetic variant was statistically associated with increased susceptibility to EC [GGvs AA: odds ratio (OR)=1.79, 95% confidence interval (CI)=1.12-2.86, P=0.014; GG vs AG/AA: OR=1.76, 95%CI=1.13-2.75, P=0.013; G vs A: OR=1.25, 95%CI=1.01-1.55, P=0.041]. The allele G and genotype GG could contribute to the increased susceptibility to EC. Our findings suggest that the c.910A>G genetic variant is associated with susceptibility to EC in the Chinese Han population, and might be used as a molecular marker for detecting susceptibility to EC.

Effects of single-dose atorvastatin on interleukin-6, interferon gamma, and myocardial no-reflow in a rabbit model of acute myocardial infarction and reperfusion

The mechanisms of statins relieving the no-reflow phenomenon and the effects of single-dose statins on it are not well known. This study sought to investigate the effects of inflammation on the no-reflow phenomenon in a rabbit model of acute myocardial infarction and reperfusion (AMI/R) and to evaluate the effects of single-dose atorvastatin on inflammation and myocardial no-reflow. Twenty-four New Zealand white male rabbits (5-6 months old) were randomized to three groups of eight: a sham-operated group, an AMI/R group, and an atorvastatin-treated group (10 mg/kg). Animals in the latter two groups were subjected to 4 h of coronary occlusion followed by 2 h of reperfusion. Serum levels of interleukin (IL)-6 were measured by enzyme-linked immunosorbent assay. The expression of interferon gamma (IFN-γ) in normal and infarcted (reflow and no-reflow) myocardial tissue was determined by immunohistochemical methods. The area of no-reflow and necrosis was evaluated pathologically. Levels of serum IL-6 were significantly lower in the atorvastatin group than in the AMI/R group (P<0.01). Expression of IFN-γ in infarcted reflow and no-reflow myocardial tissue was also significantly lower in the atorvastatin group than in the AMI/R group. The mean area of no-reflow [47.01% of ligation area (LA)] was significantly smaller in the atorvastatin group than in the AMI/R group (85.67% of LA; P<0.01). The necrosis area was also significantly smaller in the atorvastatin group (85.94% of LA) than in the AMI/R group (96.56% of LA; P<0.01). In a secondary analysis, rabbits in the atorvastatin and AMI/R groups were divided into two groups based on necrosis area (90% of LA): a small group (<90% of LA) and a large group (>90% of LA). There was no significant difference in the area of no-reflow between the small (61.40% of LA) and large groups (69.87% of LA; P>0.05). Single-dose atorvastatin protected against inflammation and myocardial no-reflow and reduced infarct size during AMI/R in rabbits. No-reflow was not dependent on the reduction of infarct size.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.