61 resultados para Diessel, Holger: Demonstratives: Form, function, and grammaticalization


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objective: To evaluate the influence of end-stage liver disease and orthotopic liver transplantation in the pituitary function and hormone metabolism before and after liver transplantation.Methods: In a prospective study, serum levels of follicle stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2) and prolactin (PRL) of 30 male patients with cirrhosis were determined two to four hours before and six months after liver transplantation. The results were compared according to the Model for End-stage Liver Disease (MELD).Results: male patients with liver cirrhosis have hypogonadism. FSH was normal, but inappropriately low due to androgen failure; E2 and PRL, on their turn, were high. After liver transplantation, FSH and LH levels increased (p < 0.05), whereas E2 and PRL normalized (p < 0.05). The MELD score did not influence changes in FSH, PRL and LH, however, the more severe the cirrhosis was, the more significant was the normalization of E2 (p = 0.01).Conclusion: Patients with cirrhosis and male hypogonadism have inappropriately normal levels of FSH and LH, associated with an increase in E2 and LRP. After liver transplantation, FSH and LH increased, while E2 and PRL returned to normal. Changes in E2 levels were most pronounced in patients with MELD > 18. The severity of cirrhosis had no influence on FSH, PRL and LH.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Teaching, research, and herd breeding applications may require calculation of breed additive contributions for direct and maternal genetic effects and fractions of heterozygosity associated with breed specific direct and maternal heterosis effects. These coefficients can be obtained from the first NB rows of a pseudo numerator relationship matrix where the first NB rows represent fractional contributions by breed to each animal or group representing a specific breed cross. The table begins with an NB x NB identity matrix representing pure breeds. Initial animals or representative crosses must be purebreds or two-breed crosses. Parents of initial purebreds are represented by the corresponding column and initial two-breed cross progeny by the two corresponding columns of the identity matrix. After that, usual rules are used to calculate the NB column entries corresponding to breeds for each animal. The NB entries are fractions of genes expected to be contributed by each of the pure breeds and correspond to the breed additive direct fractions. Entries in the column corresponding to the dam represent breed additive maternal fractions. Breed specific direct heterozygosity coefficients are entries of an NB x NB matrix formed by the outer product of the two NB by 1 columns associated with sire and dam of the animal. One minus sum of the diagonals represents total direct heterozygosity. Similarly, the NB x NB matrix formed by the outer product of columns associated with sire of dam and dam of dam contains breed specific maternal heterozygosity coefficients. These steps can be programmed to create covariates to merge with data. If X represents these coefficients for all unique breed crosses, then the reduced row echelon form function of MATLAB or SAS can be used on X to determine estimable functions of additive breed direct and maternal effects and breed specific direct and maternal heterosis effects

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cystic fibrosis (CF) is a lethal autosomal recessive genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR). Mutations in the CFTR gene may result in a defective processing of its protein and alter the function and regulation of this channel. Mutations are associated with different symptoms, including pancreatic insufficiency, bile duct obstruction, infertility in males, high sweat Cl-, intestinal obstruction, nasal polyp formation, chronic sinusitis, mucus dehydration, and chronic Pseudomonas aeruginosa and Staphylococcus aureus lung infection, responsible for 90% of the mortality of CF patients. The gene responsible for the cellular defect in CF was cloned in 1989 and its protein product CFTR is activated by an increase of intracellular cAMP. The CFTR contains two membrane domains, each with six transmembrane domain segments, two nucleotide-binding domains (NBDs), and a cytoplasmic domain. In this review we discuss the studies that have correlated the role of each CFTR domain in the protein function as a chloride channel and as a regulator of the outwardly rectifying Cl- channels (ORCCs).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Heart failure is a common endpoint for many forms of cardiovascular disease and a significant cause of morbidity and mortality. Chronic neurohumoral excitation (i.e., sympathetic hyperactivity) has been considered to be a hallmark of heart failure and is associated with a poor prognosis, cardiac dysfunction and remodeling, and skeletal myopathy. Aerobic exercise training is efficient in counteracting sympathetic hyperactivity and its toxic effects on cardiac and skeletal muscles. In this review, we describe the effects of aerobic exercise training on sympathetic hyperactivity, skeletal myopathy, as well as cardiac function and remodeling in human and animal heart failure. We also discuss the mechanisms underlying the effects of aerobic exercise training.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

OBJECTIVE: To describe the distribution of edentulism and estimate the prevalence of functional dentition and shortened dental arch among elderly population. METHODS: A population-based epidemiological study was carried out with a sample of 5,349 respondents aged 65 to 74 years obtained from the 2002 and 2003 Brazilian Ministry of Health/Division of Oral Health survey database. The following variables were studied: gender; macroregion of residence; missing teeth; percentage that met the World Health Organization goal for oral health in the age group 65 to 74 years (50% having at least 20 natural teeth); presence of shortened dental arch; number of posterior occluding pairs of teeth. The Chi-square test assessed the association between categorical variables. The Kruskal-Wallis and Mann-Whitney tests were used to assess differences of mean between number of posterior occluding pairs teeth, macro-region and gender. RESULTS: The elderly population had an average of 5.49 teeth (SD: 7.93) with a median of 0. The proportion of completely edentulous respondents was 54.7%. Complete edentulism was 18.2% in the upper arch and 1.9% in the lower arch. The World Health Organization goal was achieved in 10% of all respondents studied. However, only 2.7% had acceptable masticatory function and aesthetics (having at least shortened dental arch) and a mean number of posterior occluding pairs of 6.94 (SD=2.97). There were significant differences of the percentage of respondents that met the World Health Organization goal and presence of shortened dental arch between men and women. There were differences in shortened dental arch between macroregions. CONCLUSIONS: The Brazilian epidemiological oral health survey showed high rate of edentulism and low rate of shortened dental arch in the elderly population studied, thus suggesting significant functional and aesthetic impairment in all Brazilian macroregions especially among women.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

OBJECTIVE To analyze the regional governance of the health systemin relation to management strategies and disputes.METHODOLOGICAL PROCEDURES A qualitative study with health managers from 19 municipalities in the health region of Bahia, Northeastern Brazil. Data were drawn from 17 semi-structured interviews of state, regional, and municipal health policymakers and managers; a focus group; observations of the regional interagency committee; and documents in 2012. The political-institutional and the organizational components were analyzed in the light of dialectical hermeneutics.RESULTS The regional interagency committee is the chief regional governance strategy/component and functions as a strategic tool for strengthening governance. It brings together a diversity of members responsible for decision making in the healthcare territories, who need to negotiate the allocation of funding and the distribution of facilities for common use in the region. The high turnover of health secretaries, their lack of autonomy from the local executive decisions, inadequate technical training to exercise their function, and the influence of party politics on decision making stand as obstacles to the regional interagency committee’s permeability to social demands. Funding is insufficient to enable the fulfillment of the officially integrated agreed-upon program or to boost public supply by the system, requiring that public managers procure services from the private market at values higher than the national health service price schedule (Brazilian Unified Health System Table). The study determined that “facilitators” under contract to health departments accelerated access to specialized (diagnostic, therapeutic and/or surgical) services in other municipalities by direct payment to physicians for procedure costs already covered by the Brazilian Unified Health System.CONCLUSIONS The characteristics identified a regionalized system with a conflictive pattern of governance and intermediate institutionalism. The regional interagency committee’s managerial routine needs to incorporate more democratic devices for connecting with educational institutions, devices that are more permeable to social demands relating to regional policy making.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Four laboratory-raised colonies of two karyotypic forms of Anopheles aconitus, i.e., Form B (Chiang Mai and Phet Buri strains) and C (Chiang Mai and Mae Hong Son strains), were experimentally infected with Plasmodium falciparum and P. vivax using an artificial membrane feeding technique and dissected eight and 12 days after feeding for oocyst and sporozoite rates, respectively. The results revealed that An. aconitus Form B and C were susceptible to P. falciparum and P. vivax, i.e., Form B (Chiang Mai and Phet Buri strains/P. falciparum and P. vivax) and Form C (Chiang Mai and Mae Hong Son strains/P. vivax). Comparative statistical analyses of the oocyst rates, average number of oocysts per infected midgut and sporozoite rates among all strains of An. aconitus Form B and C to the ingroup control vectors, An. minimus A and C, exhibited mostly no significant differences, confirming the high potential vector of the two Plasmodium species. The sporozoite-like crystals found in the median lobe of the salivary glands, which could be a misleading factor in the identification of true sporozoites in salivary glands were found in both An. aconitus Form B and C.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We have studied the cardiac chronotropic responses to the Valsalva maneuver and to dynamic exercise of twenty chronic chagasic patients with normal left ventricular function and no segmental wall abnormalities by two-dimensional echocardiogram. The absolute increase in heart rate of the patients (Δ = 21.5 ± 10 bpm, M±SD) during the maneuver was significantly diminished when compared to controls (Δ = 31.30 ± 70, M±SD, p = 0.03). The minimum heart rate (58.24 ± 8.90 vs. 62.80 ± 10, p = 0.68) and the absolute decrease in heart rate at the end of the maneuver (Δ = 38.30 ± 13 vs. Δ = 31.47 ± 17, p = 0.10) were not different from controls. The initial heart rate acceleration during dynamic exercise (Δ = 12 ± 7.55 vs. Δ = 19 ± 7.27, M±SD, p = 0.01) was also diminished, but the heart rate recovery during the first ten seconds was more prominent in the sero-positive patients (Median: 14, Interquartile range: (9.75-17.50 vs. 5(0-8.75, p = 0.001). The serum levels of muscarinic cardiac auto-antibodies were significantly higher in the chagasic patients (Median: 34.58, Interquartile Range: 17-46.5, Optical Density) than in controls (Median: 0, Interquartile Range: 0-22.25, p = 0.001) and correlated significantly and directly (r = 0.68, p = 0.002) with early heart rate recovery during dynamic exercise. The results of this investigation indirectly suggest that, the cardiac muscarinic auto-antibodies may have positive agonist effects on parasympathetic heart rate control of chagasic patients.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Three patients (males, black, ages 37, 40 and 57) attended a university clinic with a progressive paraparesis of obscure origin. One patient who referred disease duration of more than 16 years, showed diminished deep reflexes, bilateral Babinski's sign, diminished sensation of vibration, abnormal bladder function and back pain. The other two patients (with one and six years of disease duration) complained of weakness in one leg, increased deep reflexes and back pain. Babinski's sign and bladder disturbance were also present in the patient with six years of disease. Blood samples tested by an enzyme immune assay and a discriminatory Western blot were positive for HTLV-I. The familial analysis of one patient showed a possible pattern of sexual and vertical transmission of the virus. To the best of our knowledge, these are the first cases of a proven association between HTLV-I and TSP/HAM in Belem, Para, and emphasize the need to actively look for cases of neurological disease associated to the virus.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Liver function and its correlation with bilirubin and hepatic enzymes were evaluated in 30 male chronic asymptomatic or oligosymptomatic alcoholics admitted into the psychiatric hospital for detoxification and treatment of alcoholism. Hypoalbuminemia, lowered prothrombin activity, hypotransferrinemia and hypofibrinogenemia were detected in 32 %, 32 %, 28 %, and 24 % of patients, respectively. Transferrin was elevated in 8 %. Greater prevalence of hyperbilirubinemia was found in patients with lowered prothrombin activity, hypofibrinogenemia, or hypotransferrinemia. No correlation was found between serum bilirubin or aminotransferase levels and normal or elevated albumin levels, time or activity of prothrombin, and fibrinogen levels. Serum alkaline phosphatase was elevated in normoalbuminemics and gamma-glutamyltransferase in patients with lowered prothrombin activity. Hypoalbuminemia was associated with hypofibrinogenemia, hypotransferrinemia with elevated aspartate aminotransferase or gamma-glutamyltransferase, and hypertransferrinemia with elevation of alanine aminotransferase. These data indicated the occurrence of hepatic dysfunction due to liver damage caused directly by alcohol or by alcoholism-associated nutritional deficiencies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

PURPOSE: Hyperglycemia and abnormal glucose tolerance tests observed in some patients with chronic Chagas' disease suggest the possibility of morphological changes in pancreatic islets and/or denervation. The purpose of this study was to describe the morphology and morphometry of pancreatic islets in chronic Chagas' disease. METHODS: Morphologic and computerized morphometric studies were performed in fragments of the head, body, and tail regions of the pancreas obtained at necropsies of 8 normal controls and 17 patients with chronic Chagas' disease: 8 with the digestive form (Megas) and 9 with the congestive heart failure form. RESULTS: The Megas group had a larger (p < 0.05) pancreatic islet area in the tail of the pancreas (10649.3 ± 4408.8 µm²) than the normal control (9481.8 ± 3242.4 µm²) and congestive heart failure (9475.1 ± 2104.9 µm²) groups; likewise, the density of the pancreatic islets (PI) was greater (1.2 ± 0.7 vs. 0.9 ± 0.6 vs. 1.9 ± 1.0 PI/mm², respectively). In the tail region of the pancreas of patients with the Megas form, there was a significant and positive correlation (r = +0.73) between the area and density of pancreatic islets. Discrete fibrosis and leukocytic infiltrates were found in pancreatic ganglia and pancreatic islets of the patients with Chagas' disease. Trypanosoma cruzi nests were not observed in the examined sections. Individuals with the Megas form of Chagas' disease showed increased area and density of pancreatic islets in the tail of the pancreas. CONCLUSION: The observed morphometric and morphologic alterations are consistent with functional changes in the pancreas, including glycemia and insulin disturbances.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

An understanding of the complex ecological interaction between fig wasps and their host plants in Amazonia requires previous knowledge of their distribution and diversity. The objective of this study was to describe the composition and structure of the wasp community associated with four species of Ficus in the municipal area of Manaus, Amazonas, Brazil. A total of 600 syconia from four species were collected. The study species were: Ficus obtusifolia Kunth; Ficus citrifolia Mill; F. americana subspecies guianensis Desv. form mathewsii; and F. americana subspecies guianensis Desv. form parkeriana. Statistical analyses were used to examine the relationship between fig wasp diversity and syconium diameter, and the effect of non-pollinating wasps on numbers of pollinators and seeds. Forty three species of fig wasp were identified, distributed across seven genera (Pegoscapus, Idarnes, Aepocerus, Physothorax, Anidarnes, Heterandrium , Eurytoma). Idarnes (carme group) was the wasps genus non-pollinator with greatest number of individuals with the greatest number of infested syconia (7409 wasps in 376 syconia). Analysing non-pollinating wasp diversity in relation to fig diameter, a significant difference was observed between the four fig species. Ficus citrifolia and F. americana subspecies guianensis form mathewsii had the smallest diameter but the greatest diversity of fig wasp. Ficus obtusifolia was the only species in which the non-pollinating wasps had a significant negative effect on the number of Pegoscapus sp. and on seed production.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A 14-year-old female patient became pregnant 6 years after heart transplantation. The pregnancy evolved uneventfully, and the newborn infant was healthy. Five months after delivery, the mother was in good condition with preserved ventricular function, and the baby had normal neuro-psychomotor development. Even though the case reported here was a success, pregnancy following cardiac transplantation is considered a high-risk condition and remains contraindicated.