Relationship between pulmonary function and indoor air pollution from coal combustion among adult residents in an inner-city area of southwest China

Few studies evaluate the amount of particulate matter less than 2.5 mm in diameter (PM2.5) in relation to a change in lung function among adults in a population. The aim of this study was to assess the association of coal as a domestic energy source to pulmonary function in an adult population in inner-city areas of Zunyi city in China where coal use is common. In a cross-sectional study of 104 households, pulmonary function measurements were assessed and compared in 110 coal users and 121 non-coal users (≥18 years old) who were all nonsmokers. Several sociodemographic factors were assessed by questionnaire, and ventilatory function measurements including forced vital capacity (FVC), forced expiratory volume in 1 s (FEV1), the FEV1/FVC ratio, and peak expiratory flow rate (PEFR) were compared between the 2 groups. The amount of PM2.5 was also measured in all residences. There was a significant increase in the relative concentration of PM2.5 in the indoor kitchens and living rooms of the coal-exposed group compared to the non-coal-exposed group. In multivariate analysis, current exposure to coal smoke was associated with a 31.7% decrease in FVC, a 42.0% decrease in FEV1, a 7.46% decrease in the FEV1/FVC ratio, and a 23.1% decrease in PEFR in adult residents. The slope of lung function decrease for Chinese adults is approximately a 2-L decrease in FVC, a 3-L decrease in FEV1, and an 8 L/s decrease in PEFR per count per minute of PM2.5 exposure. These results demonstrate the harmful effects of indoor air pollution from coal smoke on the lung function of adult residents and emphasize the need for public health efforts to decrease exposure to coal smoke.

Differing phagocytic function of monocytes and neutrophils in Chagas' cardiopathy according to the presence or absence of congestive heart failure

We evaluated the in vitro phagocytic function and the production of microbicidal oxygen radicals by monocytes and neutrophils of 9 Chagas' heart disease subjects with heart failure and 9 without the syndrome in comparison with 11 healthy subjects, by assessing phagocytosis of Saccharomyces cerevisiae and NBT reduction by peripheral blood phagocytes. Phagocytic index of monocytes of chagasics without heart failure was significantly 6.7 and 10.6 times lower than those of controls and chagasics with the congestive syndrome, respectively, due to a lesser engagement in phagocytosis and to an inability of these cells to ingest particles. Neutrophils also show in chagasics without heart failure PI 11.2 and 19.8 times lower than that of controls and chagasics with heart failure, respectively. The percent of NBT reduction was normal and similar for the three groups. Balanced opposite effects of cardiovascular and immune disturbances may be acting in Chagas' disease subjects with heart failure paradoxically recovering the altered phagocytic function.

Electromyography function, disability degree, and pain in leprosy patients undergoing neural mobilization treatment

INTRODUCTION: This study aimed to evaluate the effect of the neural mobilization technique on electromyography function, disability degree, and pain in patients with leprosy. METHODS: A sample of 56 individuals with leprosy was randomized into an experimental group, composed of 29 individuals undergoing treatment with neural mobilization, and a control group of 27 individuals who underwent conventional treatment. In both groups, the lesions in the lower limbs were treated. In the treatment with neural mobilization, the procedure used was mobilization of the lumbosacral roots and sciatic nerve biased to the peroneal nerve that innervates the anterior tibial muscle, which was evaluated in the electromyography. RESULTS: Analysis of the electromyography function showed a significant increase (p<0.05) in the experimental group in both the right (Δ%=22.1, p=0.013) and the left anterior tibial muscles (Δ%=27.7, p=0.009), compared with the control group pre- and post-test. Analysis of the strength both in the movement of horizontal extension (Δ%right=11.7, p=0.003/Δ%left=27.4, p=0.002) and in the movement of back flexion (Δ%right=31.1; p=0.000/Δ%left=34.7, p=0.000) showed a significant increase (p<0.05) in both the right and the left segments when comparing the experimental group pre- and post-test. The experimental group showed a significant reduction (p=0.000) in pain perception and disability degree when the pre- and post-test were compared and when compared with the control group in the post-test. CONCLUSIONS: Leprosy patients undergoing the technique of neural mobilization had an improvement in electromyography function and muscle strength, reducing disability degree and pain.

Morphological and functional study of the marginal sphincter of the sea anemones Phymactis clematis and Aulactinia marplatensis from intertidal of Mar del Plata, Argentina

It was made the characterization of marginal sphincter to the species Phymactis clematis (Drayton in Dana, 1849) and Aulactinia marplatensis (Zamponi, 1977), from intertidal ecosystem through their morphogical and functional study. The species P. clematis has a circumscript sphincter of palmate type. This muscle is constituted by a mesogloeal axis and several mesogloeal subaxes. Axis as well as subaxes give a support to the endoderm which border is smooth. Aulactinia marplatensis has a circunscript sphincter pinnate type. The axis has a truncated cone shape while in P. clematis the shape is cylindrical on its origin and it is bifurcated at the end. Both species experiments were carried out using the isolated muscles. They were stimulated at increasing KCl concentrations ranging from 20 to 200 mM. The results were analysed in the form of dose-response curves expressed in tension in grams force vs concentration. Contractil force increases in a sigmoid form to increasing KCl concentrations. The correlation between morphology and function and the differences shown in both species would be related to their intertidal distribution.

Hypothalamic-pituitary-gonadal function in men with liver cirrhosis before and after liver transplantation

Objective: To evaluate the influence of end-stage liver disease and orthotopic liver transplantation in the pituitary function and hormone metabolism before and after liver transplantation.Methods: In a prospective study, serum levels of follicle stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2) and prolactin (PRL) of 30 male patients with cirrhosis were determined two to four hours before and six months after liver transplantation. The results were compared according to the Model for End-stage Liver Disease (MELD).Results: male patients with liver cirrhosis have hypogonadism. FSH was normal, but inappropriately low due to androgen failure; E2 and PRL, on their turn, were high. After liver transplantation, FSH and LH levels increased (p < 0.05), whereas E2 and PRL normalized (p < 0.05). The MELD score did not influence changes in FSH, PRL and LH, however, the more severe the cirrhosis was, the more significant was the normalization of E2 (p = 0.01).Conclusion: Patients with cirrhosis and male hypogonadism have inappropriately normal levels of FSH and LH, associated with an increase in E2 and LRP. After liver transplantation, FSH and LH increased, while E2 and PRL returned to normal. Changes in E2 levels were most pronounced in patients with MELD > 18. The severity of cirrhosis had no influence on FSH, PRL and LH.

Structure and function of the cystic fibrosis transmembrane conductance regulator

Cystic fibrosis (CF) is a lethal autosomal recessive genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR). Mutations in the CFTR gene may result in a defective processing of its protein and alter the function and regulation of this channel. Mutations are associated with different symptoms, including pancreatic insufficiency, bile duct obstruction, infertility in males, high sweat Cl-, intestinal obstruction, nasal polyp formation, chronic sinusitis, mucus dehydration, and chronic Pseudomonas aeruginosa and Staphylococcus aureus lung infection, responsible for 90% of the mortality of CF patients. The gene responsible for the cellular defect in CF was cloned in 1989 and its protein product CFTR is activated by an increase of intracellular cAMP. The CFTR contains two membrane domains, each with six transmembrane domain segments, two nucleotide-binding domains (NBDs), and a cytoplasmic domain. In this review we discuss the studies that have correlated the role of each CFTR domain in the protein function as a chloride channel and as a regulator of the outwardly rectifying Cl- channels (ORCCs).

Effect of strenuous maternal exercise before and during pregnancy on rat progeny renal function

The effects of strenuous exercise before and during pregnancy on the renal function and morphological alterations of the progeny were determined in a study on female Wistar rats. This research was done based on a previous study carried out in our laboratory, which showed morphological alterations in rats submitted to this kind of exercise. As the form is related to the function, the physiological relevance of submitting a pregnant female to a high-intensity exercise training regimen could be explained by the fact that morphological alterations can influence kidney function. The animals were assigned to one of two groups: control animals that did not exercise during pregnancy and trained animals that swam for 120 min 5 days a week for 8 weeks before pregnancy and daily for 60 min over a period of 8 weeks starting on the second day of pregnancy. Seven rats of each group were analyzed for morphological alterations and for renal function. The progeny of the rats used for morphological evaluation were born by cesarean section and the progeny of the animals used to evaluate renal function were born normally. The progeny were two months old when renal function was evaluated. Fertility and morbidity were the same for both groups. Strenuous maternal exercise had no significant influence on glomerular filtration rate (GFR) but renal plasma flow was lower in the progeny of the trained group (mean ± SD, 16.65 ± 3.77 ml min-1 kg-1) compared to the progeny of the control group (33.42 ± 2.56 ml min-1 kg-1). Antidiuretic and antinatriuretic effects on the progeny of the trained group were observed, since urine flow as percentage of GFR and the fraction of urinary sodium excretion were lower in this group (1.38 ± 0.10 and 0.60 ± 0.04%, respectively) compared to the progeny of the control group (2.36 ± 0.11 and 1.55 ± 0.20%, respectively). Moreover, in this exercise program, fetuses from trained animals were small-sized (2.45 ± 0.19 vs 4.66 ± 2.45 g for control animals) and showed lower differentiation compared to fetuses from the control group. These effects were probably caused by caloric restriction, hypoxia and reduction of umbilical cord length.

Mesopic radial frequency contrast sensitivity function for young and older adults

The objective of the present study was to determine contrast sensitivity curves of concentric circular patterns with radial frequencies of 0.25, 0.5, 1.0, 2.0, and 4.0 cycles per degree in young and older adult volunteers. These parameters were also compared with sensitivity contrasts for sine-wave gratings. All participants had normal acuity vision and were free of identifiable ocular illness. Contrast sensitivity was measured in 6 young adults aged 19 to 23 years and 6 older adults aged 60 to 69 years using the psychophysical forced-choice method. In this paradigm the volunteers had to decide which of two stimuli contained the above radial frequencies at low contrast levels. The other neutral stimulus was gray with homogeneous luminance. We detected a decline in contrast sensitivity for older adults at all radial frequencies compared to young adults. Also, contrast sensitivity for sine-wave gratings at all measured frequencies was better, as predicted, for all young adults. Maximum sensitivities in the radial frequency contrast sensitivity function and contrast sensitivity function occurred at 0.25 and 0.5 cycles per degree, respectively, for both young and older adults. These results suggest age-related changes in the contrast sensitivity function for concentric symmetrical stimuli.

Aerobic exercise training in heart failure: impact on sympathetic hyperactivity and cardiac and skeletal muscle function

Heart failure is a common endpoint for many forms of cardiovascular disease and a significant cause of morbidity and mortality. Chronic neurohumoral excitation (i.e., sympathetic hyperactivity) has been considered to be a hallmark of heart failure and is associated with a poor prognosis, cardiac dysfunction and remodeling, and skeletal myopathy. Aerobic exercise training is efficient in counteracting sympathetic hyperactivity and its toxic effects on cardiac and skeletal muscles. In this review, we describe the effects of aerobic exercise training on sympathetic hyperactivity, skeletal myopathy, as well as cardiac function and remodeling in human and animal heart failure. We also discuss the mechanisms underlying the effects of aerobic exercise training.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Histopathological analysis of pre-implantation donor kidney biopsies: association with graft survival and function in one year post-transplantation

Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.