Reference values for lung function tests: III. Carbon monoxide diffusing capacity (transfer factor)

Carbon monoxide diffusing capacity (DLCO) or transfer factor (TLCO) is a particularly useful test of the appropriateness of gas exchange across the lung alveolocapillary membrane. With the purpose of establishing predictive equations for DLCO using a non-smoking sample of the adult Brazilian population, we prospectively evaluated 100 subjects (50 males and 50 females aged 20 to 80 years), randomly selected from more than 8,000 individuals. Gender-specific linear prediction equations were developed by multiple regression analysis with single breath (SB) absolute and volume-corrected (VA) DLCO values as dependent variables. In the prediction equations, age (years) and height (cm) had opposite effects on DLCOSB (ml min-1 mmHg-1), independent of gender (-0.13 (age) + 0.32 (height) - 13.07 in males and -0.075 (age) + 0.18 (height) + 0.20 in females). On the other hand, height had a positive effect on DLCOSB but a negative one on DLCOSB/VA (P<0.01). We found that the predictive values from the most cited studies using predominantly Caucasian samples were significantly different from the actually measured values (P<0.05). Furthermore, oxygen uptake at maximal exercise (VO2max) correlated highly to DLCOSB (R = 0.71, P<0.001); this variable, however, did not maintain an independent role to explain the VO2max variability in the multiple regression analysis (P>0.05). Our results therefore provide an original frame of reference for either DLCOSB or DLCOSB/VA in Brazilian males and females aged 20 to 80 years, obtained from the standardized single-breath technique.

Performance of two-dimensional Doppler echocardiography for the assessment of infarct size and left ventricular function in rats

Although echocardiography has been used in rats, few studies have determined its efficacy for estimating myocardial infarct size. Our objective was to estimate the myocardial infarct size, and to evaluate anatomic and functional variables of the left ventricle. Myocardial infarction was produced in 43 female Wistar rats by ligature of the left coronary artery. Echocardiography was performed 5 weeks later to measure left ventricular diameter and transverse area (mean of 3 transverse planes), infarct size (percentage of the arc with infarct on 3 transverse planes), systolic function by the change in fractional area, and diastolic function by mitral inflow parameters. The histologic measurement of myocardial infarction size was similar to the echocardiographic method. Myocardial infarct size ranged from 4.8 to 66.6% when determined by histology and from 5 to 69.8% when determined by echocardiography, with good correlation (r = 0.88; P < 0.05; Pearson correlation coefficient). Left ventricular diameter and mean diastolic transverse area correlated with myocardial infarct size by histology (r = 0.57 and r = 0.78; P < 0.0005). The fractional area change ranged from 28.5 ± 5.6 (large-size myocardial infarction) to 53.1 ± 1.5% (control) and correlated with myocardial infarct size by echocardiography (r = -0.87; P < 0.00001) and histology (r = -0.78; P < 00001). The E/A wave ratio of mitral inflow velocity for animals with large-size myocardial infarction (5.6 ± 2.7) was significantly higher than for all others (control: 1.9 ± 0.1; small-size myocardial infarction: 1.9 ± 0.4; moderate-size myocardial infarction: 2.8 ± 2.3). There was good agreement between echocardiographic and histologic estimates of myocardial infarct size in rats.

Mesopic radial frequency contrast sensitivity function for young and older adults

The objective of the present study was to determine contrast sensitivity curves of concentric circular patterns with radial frequencies of 0.25, 0.5, 1.0, 2.0, and 4.0 cycles per degree in young and older adult volunteers. These parameters were also compared with sensitivity contrasts for sine-wave gratings. All participants had normal acuity vision and were free of identifiable ocular illness. Contrast sensitivity was measured in 6 young adults aged 19 to 23 years and 6 older adults aged 60 to 69 years using the psychophysical forced-choice method. In this paradigm the volunteers had to decide which of two stimuli contained the above radial frequencies at low contrast levels. The other neutral stimulus was gray with homogeneous luminance. We detected a decline in contrast sensitivity for older adults at all radial frequencies compared to young adults. Also, contrast sensitivity for sine-wave gratings at all measured frequencies was better, as predicted, for all young adults. Maximum sensitivities in the radial frequency contrast sensitivity function and contrast sensitivity function occurred at 0.25 and 0.5 cycles per degree, respectively, for both young and older adults. These results suggest age-related changes in the contrast sensitivity function for concentric symmetrical stimuli.

Exercise training and detraining modify the morphological and mechanical properties of single cardiac myocytes obtained from spontaneously hypertensive rats

We determined the effects of exercise training and detraining on the morphological and mechanical properties of left ventricular myocytes in 4-month-old spontaneously hypertensive rats (SHR) randomly divided into the following groups: sedentary for 8 weeks (SED-8), sedentary for 12 weeks (SED-12), treadmill-running trained for 8 weeks (TRA, 16 m/min, 60 min/day, 5 days/week), and treadmill-running trained for 8 weeks followed by 4 weeks of detraining (DET). At sacrifice, left ventricular myocytes were isolated enzymatically, and resting cell length, width, and cell shortening after stimulation at a frequency of 1 Hz (~25°C) were measured. Cell length was greater in TRA than in SED-8 (161.30 ± 1.01 vs 156.10 ± 1.02 μm, P < 0.05, 667 vs 618 cells, respectively) and remained larger after detraining. Cell width and volume were unaffected by either exercise training or detraining. Cell length to width ratio was higher in TRA than in SED-8 (8.50 ± 0.08 vs 8.22 ± 0.10, P < 0.05) and was maintained after detraining. Exercise training did not affect cell shortening, which was unchanged with detraining. TRA cells exhibited higher maximum velocity of shortening than SED-8 (102.01 ± 4.50 vs 82.01 ± 5.30 μm/s, P < 0.05, 70 cells per group), with almost complete regression after detraining. The maximum velocity of relengthening was higher in TRA cells than in SED-8 (88.20 ± 4.01 vs70.01 ± 4.80 μm/s, P < 0.05), returning to sedentary values with detraining. Therefore, exercise training affected left ventricle remodeling in SHR towards eccentric hypertrophy, which remained after detraining. It also improved single left ventricular myocyte contractile function, which was reversed by detraining.

Differential effects of aging on spatial contrast sensitivity to linear and polar sine-wave gratings

Changes in visual function beyond high-contrast acuity are known to take place during normal aging. We determined whether sensitivity to linear sine-wave gratings and to an elementary stimulus preferentially processed in extrastriate areas could be distinctively affected by aging. We measured spatial contrast sensitivity twice for concentric polar (Bessel) and vertical linear gratings of 0.6, 2.5, 5, and 20 cycles per degree (cpd) in two age groups (20-30 and 60-70 years). All participants were free of identifiable ocular disease and had normal or corrected-to-normal visual acuity. Participants were more sensitive to Cartesian than to polar gratings in all frequencies tested, and the younger adult group was more sensitive to all stimuli tested. Significant differences between sensitivities of the two groups were found for linear (only 20 cpd; P<0.01) and polar gratings (all frequencies tested; P<0.01). The young adult group was significantly more sensitive to linear than to circular gratings in the 20 cpd frequency. The older adult group was significantly more sensitive to linear than to circular gratings in all spatial frequencies, except in the 20 cpd frequency. The results suggest that sensitivity to the two kinds of stimuli is affected differently by aging. We suggest that neural changes in the aging brain are important determinants of this difference and discuss the results according to current models of human aging.

Acute effect of alcohol intake on sine-wave Cartesian and polar contrast sensitivity functions

The aim of this study was to assess contrast sensitivity for angular frequency stimuli as well as for sine-wave gratings in adults under the effect of acute ingestion of alcohol. We measured the contrast sensitivity function (CSF) for gratings of 0.25, 1.25, 2.5, 4, 10, and 20 cycles per degree of visual angle (cpd) as well as for angular frequency stimuli of 1, 2, 4, 24, 48, and 96 cycles/360°. Twenty adults free of ocular diseases, with normal or corrected-to-normal visual acuity, and no history of alcoholism were enrolled in two experimental groups: 1) no alcohol intake (control group) and 2) alcohol ingestion (experimental group). The average concentration of alcohol in the experimental group was set to about 0.08%. We used a paradigm involving a forced-choice method. Maximum sensitivity to contrast for sine-wave gratings in the two groups occurred at 4 cpd sine-wave gratings and at 24 and 48 cycles/360° for angular frequency stimuli. Significant changes in contrast sensitivity were observed after alcohol intake compared with the control condition at spatial frequency of 4 cpd and 1, 24, and 48 cycles/360° for angular frequency stimuli. Alcohol intake seems to affect the processing of sine-wave gratings at maximum sensitivity and at the low and high frequency ends for angular frequency stimuli, both under photopic luminance conditions.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Effect of salt intake and potassium supplementation on brachial-ankle pulse wave velocity in Chinese subjects: an interventional study

Accumulating evidence has suggested that high salt and potassium might be associated with vascular function. The aim of this study was to investigate the effect of salt intake and potassium supplementation on brachial-ankle pulse wave velocity (PWV) in Chinese subjects. Forty-nine subjects (28-65 years of age) were selected from a rural community of northern China. All subjects were sequentially maintained on a low-salt diet for 7 days (3.0 g/day NaCl), a high-salt diet for an additional 7 days (18.0 g/day NaCl), and a high-salt diet with potassium supplementation for a final 7 days (18.0 g/day NaCl+4.5 g/day KCl). Brachial-ankle PWV was measured at baseline and on the last day of each intervention. Blood pressure levels were significantly increased from the low-salt to high-salt diet, and decreased from the high-salt diet to high-salt plus potassium supplementation. Baseline brachial-ankle PWV in salt-sensitive subjects was significantly higher than in salt-resistant subjects. There was no significant change in brachial-ankle PWV among the 3 intervention periods in salt-sensitive, salt-resistant, or total subjects. No significant correlations were found between brachial-ankle PWV and 24-h sodium and potassium excretions. Our study indicates that dietary salt intake and potassium supplementation, at least in the short term, had no significant effect on brachial-ankle PWV in Chinese subjects.

Effects of disturbed blood flow during exercise on endothelial function: a time course analysis

This study aimed to examine the time course of endothelial function after a single handgrip exercise session combined with blood flow restriction in healthy young men. Nine participants (28±5.8 years) completed a single session of bilateral dynamic handgrip exercise (20 min with 60% of the maximum voluntary contraction). To induce blood flow restriction, a cuff was placed 2 cm below the antecubital fossa in the experimental arm. This cuff was inflated to 80 mmHg before initiation of exercise and maintained through the duration of the protocol. The experimental arm and control arm were randomly selected for all subjects. Brachial artery flow-mediated dilation (FMD) and blood flow velocity profiles were assessed using Doppler ultrasonography before initiation of the exercise, and at 15 and 60 min after its cessation. Blood flow velocity profiles were also assessed during exercise. There was a significant increase in FMD 15 min after exercise in the control arm compared with before exercise (64.09%±16.59%, P=0.001), but there was no change in the experimental arm (-12.48%±12.64%, P=0.252). FMD values at 15 min post-exercise were significantly higher for the control arm in comparison to the experimental arm (P=0.004). FMD returned to near baseline values at 60 min after exercise, with no significant difference between arms (P=0.424). A single handgrip exercise bout provoked an acute increase in FMD 15 min after exercise, returning to near baseline values at 60 min. This response was blunted by the addition of an inflated pneumatic cuff to the exercising arm.

Effect of hyperbaric oxygenation on mitochondrial function of neuronal cells in the cortex of neonatal rats after hypoxic-ischemic brain damage

The timing and mechanisms of protection by hyperbaric oxygenation (HBO) in hypoxic-ischemic brain damage (HIBD) have only been partially elucidated. We monitored the effect of HBO on the mitochondrial function of neuronal cells in the cerebral cortex of neonatal rats after HIBD. Neonatal Sprague-Dawley rats (total of 360 of both genders) were randomly divided into normal control, HIBD, and HIBD+HBO groups. The HBO treatment began immediately after hypoxia-ischemia (HI) and continued once a day for 7 consecutive days. Animals were euthanized 0, 2, 4, 6, and 12 h post-HI to monitor the changes in mitochondrial membrane potential (ΔΨm) occurring soon after a single dose of HBO treatment, as well as 2, 3, 4, 5, 6, and 7 days post-HI to study ΔΨm changes after a series of HBO treatments. Fluctuations in ΔΨm were observed in the ipsilateral cortex in both HIBD and HIBD+HBO groups. Within 2 to 12 h after HI insult, the ΔΨm of the HIBD and HIBD+HBO groups recovered to some extent. A secondary drop in ΔΨm was observed in both groups during the 1-4 days post-HI period, but was more severe in the HIBD+HBO group. There was a secondary recovery of ΔΨm observed in the HIBD+HBO group, but not in the HIBD group, during the 5-7 days period after HI insult. HBO therapy may not lead to improvement of neural cell mitochondrial function in the cerebral cortex in the early stage post-HI, but may improve it in the sub-acute stage post-HI.

Tuberculosis in renal transplant patients: The experience of a single center in Medellín-Colombia, 2005-2013

Introduction: Tuberculosis is a common opportunistic infection in renal transplant patients. Objective: To obtain a clinical and laboratory description of transplant patients diagnosed with tuberculosis and their response to treatment during a period ranging from 2005 to 2013 at the Pablo Tobón Uribe Hospital. Methods: Retrospective and descriptive study. Results: In 641 renal transplants, tuberculosis was confirmed in 12 cases. Of these, 25% had a history of acute rejection, and 50% had creatinine levels greater than 1.5 mg/dl prior to infection. The disease typically presented as pulmonary (50%) and disseminated (33.3%). The first phase of treatment consisted of 3 months of HZRE (isoniazid, pyrazinamide, rifampicin and ethambutol) in 75% of the cases and HZME (isoniazid, pyrazinamide, moxifloxacin and ethambutol) in 25% of the cases. During the second phase of the treatment, 75% of the cases received isoniazid and rifampicin, and 25% of the cases received isoniazid and ethambutol. The length of treatment varied between 6 and 18 months. In 41.7% of patients, hepatotoxicity was associated with the beginning of anti-tuberculosis therapy. During a year-long follow-up, renal function remained stable, and the mortality rate was 16.7%. Conclusion: Tuberculosis in the renal transplant population studied caused diverse nonspecific symptoms. Pulmonary and disseminated tuberculosis were the most frequent forms and required prolonged treatment. Antituberculosis medications had a high toxicity and mortality. This infection must be considered when patients present with a febrile syndrome of unknown origin, especially during the first year after renal transplant.