175 resultados para repetitive DNA
Resumo:
The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp) sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.
Resumo:
Coxiella burnetii is the agent of Q fever , an emergent worldwide zoonosis of wide clinical spectrum. Although C. burnetii infection is typically associated with acute infection, atypical pneumonia and flu-like symptoms, endocarditis, osteoarticular manifestations and severe disease are possible, especially when the patient has a suppressed immune system; however, these severe complications are typically neglected. This study reports the sequencing of the repetitive element IS1111 of the transposase gene of C. burnetii from blood and bronchoalveolar lavage (BAL) samples from a patient with severe pneumonia following methotrexate therapy, resulting in the molecular diagnosis of Q fever in a patient who had been diagnosed with active seronegative polyarthritis two years earlier. To the best of our knowledge, this represents the first documented case of the isolation of C. burnetii DNA from a BAL sample.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Foi realizado diagnóstico para leishmaniose tegumentar americana a partir de sangue de pacientes residentes em dois municípios endêmicos do estado de Pernambuco. O DNA de 119 amostras de sangue foi extraído e submetido a reação em cadeia da polimerase. Utilizaram-se primers do minicírculo do DNA do cinetoplasto (kDNA) de Leishmania braziliensis, circulante em Pernambuco, cuja seqüência-alvo gera um fragmento de 750 pares de bases. No total 58 (48,7%) indivíduos apresentaram amplificação positiva e 61 (51,3%) negativa. Das amostras positivas para a PCR, 37 (≅ 64%) pertenciam a indivíduos tratados e sem lesão. Conclui-se que a técnica de PCR é eficaz para identificar o DNA de leishmânia em material de biópsias e em sangue venoso.
Resumo:
The detection of HBV-DNA in serum by molecular hybridization is the most sensitive and specific marker of replication and infectivity of hepatitis B virus and currently is proposed as a routine diagnostic technique in the follow-up of HBV - related diseases. Comparing different techniques already described, we found that direct spotting of serum samples on nitrocellulose membranes under vacuum filtration, followed by denaturing and neutralizing washes is more practical, simple, sensible and reproducible. DNA polymerase assay using phosphonoformic acid as specific viral inhibitor has shown 86.8% of concordance with HBV-DNA detection, and so, it is an useful alternative in the follow-up of hepatitis B chronic patients. We found 19.2% HBeAg positive samples with no other markers of viral replication and no anti-HBe positive sample had detectable HBV-DNA. Discordance between the 2 systems have been extensively described, and we confirm this for the first time in our country. Molecular biological techniques are essential to determine the replication status of chronic hepatitis B patients.
Resumo:
Serum samples from 356 HBsAg positive asymptomatic carriers, which were titrated by reverse passive hemagglutination, were analysed for the presence of HBV-DNA, HBsAg and IgM anti-HBc. The samples were divided in three classes, according to the titers of HBsAg and IgM anti-HBc and the distribution of HBV-DNA and HBsAg among these classes was studied. In the high titer class of HBsAg, 65% of samples have one or both markers against only 19% in the low titer class. From the total of 356 samples, 121 gave positive results for IgM anti-HBc (33.9%). From these, 38.9% of HBV-DNA and 47.9% of HBeAg were observed, whereas in samples with absence of IgM anti-HBc, 18.3% and 16.6% were respectively found. A higher frequency of agreement between all these markers was found in the class of high titers of HBsAg; however, HBV-DNA was detected in the low titer class of HBsAg and little or no IgM anti-HBc, showing potential blood infectivity even in HBsAg positive borderline samples.
Resumo:
Specimens from cervical dysplasias or carcinomas and genital condylomata acuminata were retrospectively analysed by in situ hybridization (ISH) with bioti-nylated DNA probes for human papillomavirus (HPV) types 6, 11, 16 and 18. In the control group no case was positive for HPV DNA. In mild/moderate dysplasias, 4 cases (14%) were positive for HPV 6 or 11 and 2 cases (7%), for HPV 16. In the severe dysplasia/in situ carcinoma group, 9 cases (31%) showed presence of DNA of HPV types 16 or 18. Six invasive carcinomas (20%) were positive for HPV type 16 or 18. Among condylomata acuminata, 22 cases (73%) were positive for HPV types 6 or 11. In all ISH-positive cases only one viral type was detected. No correlation between HPV DNA positivity and histological findings of HPV infection was observed. Although less sensitive than some other molecular biology techniques, in situ hybridization with biotinylated DNA probes proved to be simple and useful for detecting and typing HPV in samples routinely received for histopathological analysis.
Resumo:
A previous seroepidemiological study in the rural zone of Vargem Alta (ES) SouthEast of Brazil, showed a prevalence of up to 9% of hepatitis B surface antigen (HBsAg) in some areas. One hundred susceptible children aging 1 to 5 years old were selected and immunized with a recombinant DNA hepatitis B vaccine (Smith-Kline 20 mcg) using the 0-1-6 months vaccination schedule. Blood samples were collected at the time of the first vaccine dose (month 0) in order to confirm susceptible individuals and 1,3,6 and 8 months after the first dose , to evaluate the antibody response. Our results showed that two and five months after the second dose, 79% and 88% of children seroconverted respectively, reaching 97% after the third dose. The levels of anti-HBs were calculated in milli International Units/ml (mIU/ml) and demonstrated the markedly increase of protective levels of antibodies after the third dose. These data showed a good immunogenicity of the DNA recombinant hepatitis B vaccine when administered in children of endemic areas.
Resumo:
Detection of HBV-DNA by PCR was compared with other serological markers (HBsAg, HBeAg and anti-HBe) in a series of49 Chronic Hepatitis B patients, including 12 with a spontaneous clearance of HBsAg. None of these HBsAg negative cases were PCR positive, but 33/37 (89.2%) HBsAg positive cases were PCR positive (p < 0.0001). Among HBsAg positive samples, nine cases were HBeAg positive and anti-HBe negative, all of them PCR positive. Other 3 patients were HBeAg and anti-HBe positive and these cases were also found PCR positive. A third group included 21 patients anti-HBe positive and HBeAg negative: 19 of them were PCR positive and 2 were PCR negative. The last 4 cases were HBeAg and anti-HBe negative, two of them were PCR positive. The detection of anti-HBe viremic cases in the present series suggest that preC variants could occur in our country. In conclusion, the integrated phase o f chronic hepatitis B seems to be less frequent than it was assumed, when only HBeAg or dot blot hybridization techniques were used. The new term "low replication phase" might favorably replace the former "integrated phase".
Resumo:
The phlebotomine sand fly Lutzomyia longipalpis has been incriminated as a vector of American visceral leishmaniasis, caused by Leishmania chagasi. However, some evidence has been accumulated suggesting that it may exist in nature not as a single but as a species complex. Our goal was to compare four laboratory reference populations of L. longipalpis from distinct geographic regions at the molecular level by RAPD-PCR. We screened genomic DNA for polymorphic sites by PCR amplification with decamer single primers of arbitrary nucleotide sequences. One primer distinguished one population (Marajó Island, Pará State, Brazil) from the other three (Lapinha Cave, Minas Gerais State, Brazil; Melgar, Tolima Department, Colombia and Liberia, Guanacaste Province, Costa Rica). The population-specific and the conserved RAPD-PCR amplified fragments were cloned and shown to differ only in number of internal repeats.
Resumo:
We describe a case of human T-lymphotropic virus type I associated myelopathy in a 50-year old woman in Nigeria. The patient presented with progressive loss of tone to the two lower limbs and later inability to walk. The HTLV-I antibody presence in the plasma collected from the patient was repeatedly detected by enzyme immunoassays (Abbott HTLV-I EIA and Coulter SELECT-HTLV I/II) and confirmed by Western blot technique. In addition, HTLV-I DNA was amplified from the genomic DNA isolated from the peripheral blood mononuclear cells of the patient by the polymerase chain reaction technique. This finding is significant being the first report of association of HTLV-I with myelopathy in Nigeria.
Resumo:
Susceptibility of snails to infection by certain trematodes and their suitability as hosts for continued development has been a bewildering problem in host-parasite relationships. The present work emphasizes our interest in snail genetics to determine what genes or gene products are specifically responsible for susceptibility of snails to infection. High molecular weight DNA was extracted from both susceptible and non-susceptible snails within the same species Biomphalaria tenagophila. RAPD was undertaken to distinguish between the two types of snails. Random primers (10 mers) were used to amplify the extracted DNA by the polymerase chain reaction (PCR) followed by polyacrylamide gel electrophoresis (PAGE) and silver staining. The results suggest that RAPD represents an efficient means of genome comparison, since many molecular markers were detected as genetic variations between susceptible and non-susceptible snails.
Resumo:
Differences were detected in the gene expression of strains of E. histolytica using RNA (RAP-PCR) and DNA fingerprinting (RAPD). Analysis of the electrophoretic profiles of the gels revealed some polymorphic markers that could be used in the individual characterization of the strains. The 260 bands generated by using five different primers for RAP-PCR, as well as RAPD, were employed in the construction of dendograms. The dendogram obtained based on the RAPD products permitted the distinction of symptomatic and asymptomatic isolates, as well the correlation between the polymorphism exhibited and the virulence of the strains. The dendogram obtained for the RAP-PCR products did not show a correlation with the virulence of the strains but revealed a high degree of intraspecific transcriptional variability that could be related to other biological features, whether or not these are involved in the pathogenesis of amebiasis.
Resumo:
The presence of serological markers for hepatitis B virus (HBsAg, anti-HBc IgM and Anti-HBc total) was investigated in the serum of 1,396 individuals who had clinical suspect of hepatitis. It was observed that 50.7% of the individuals were positive and, from the total of the studied individuals, 14.5% were positive for HBsAg. From these, 8.5% were also positive for anti-HBc IgM. The analysis in relation to gender showed a higher seroprevalence index among male individuals (p < 0.0001). It was observed the occurrence of subtypes adw2 (62.7%), ayw3 (23.5%), ayw2 (9.8%) and adw4 (3.9%). The viral DNA was detected in 61 (33.9%) HBsAg positive samples and in one sample positive only for anti-HBc total. These results indicate an important incidence of the HBV infection in this population, and reinforce previous studies regarding this virus in the central west region of Brazil.