27 resultados para mRNA
Resumo:
Interferon (IFN)-alpha receptor mRNA expression in liver of patients with chronic hepatitis C has been shown to be a response to IFN-alpha therapy. The objective of the present study was to determine whether the expression of mRNA for subunit 1 of the IFN-alpha receptor (IFNAR1) in peripheral blood mononuclear cells (PBMC) is associated with the response to IFN-alpha in patients with chronic hepatitis C. Thirty patients with positive anti-HCV and HCV-RNA, and abnormal levels of alanine aminotransferase in serum were selected and treated with IFN-alpha2b for one year. Those with HBV or HIV infection, or using alcohol were not included. Thirteen discontinued the treatment and were not evaluated. The IFN-alpha response was monitored on the basis of alanine aminotransferase level and positivity for HCV-RNA in serum. IFNAR1-mRNA expression in PBMC was measured by reverse transcription-polymerase chain reaction before and during the first three months of therapy. The results are reported as IFNAR1-mRNA/ß-actin-mRNA ratio (mean ± SD). Before treatment, responder patients had significantly higher IFNAR1-mRNA expression in PBMC (0.67 ± 0.15; N = 5; P < 0.05) compared to non-responders (0.35 ± 0.17; N = 12) and controls (0.30 ± 0.16; N = 9). Moreover, IFNAR1-mRNA levels were significantly reduced after 3 months of treatment in responders, whereas there were no differences in IFNAR1 expression in non-responders during IFN-alpha therapy. Basal IFNAR1-mRNA expression was not correlated with the serum level of alanine and aspartate aminotransferases or the presence of cirrhosis. The present results suggest that IFNAR1-mRNA expression in PBMC is associated with IFN-alpha response to hepatitis C and may be useful for monitoring therapy in patients with chronic hepatitis C.
Resumo:
The aim of the present study was to assess the effects of endurance training on leptin levels and adipose tissue gene expression and their association with insulin, body composition and energy intake. Male Wistar rats were randomly divided into two groups: trained (N = 18) and sedentary controls (N = 20). The trained group underwent swimming training for 9 weeks. Leptin and insulin levels, adiposity and leptin gene expression in epididymal and inguinal adipose tissue were determined after training. There were no differences in energy intake between groups. Trained rats had a decreased final body weight (-10%), relative and total body fat (-36 and -55%, respectively) and insulin levels (-55%) compared with controls (P < 0.05). Although trained animals showed 56% lower leptin levels (2.58 ± 1.05 vs 5.89 ± 2.89 ng/mL in control; P < 0.05), no difference in leptin gene expression in either fat depot was demonstrable between groups. Stepwise multiple regression analysis showed that lower leptin levels in trained rats were due primarily to their lower body fat mass. After adjustment for total body fat, leptin levels were still 20% (P < 0.05) lower in exercised rats. In conclusion, nine weeks of swimming training did not affect leptin gene expression, but did lead to a decrease in leptin levels that was independent of changes in body fat.
Resumo:
Female rats are intensely affected by cocaine, with estrogen probably playing an important role in this effect. Progesterone modulates the GABA system and attenuates the effects of cocaine; however, there is no information about its relevance in changing GABA synthesis pathways after cocaine administration to female rats. Our objective was to investigate the influence of progesterone on the effects of repeated cocaine administration on the isoenzymes of glutamic acid decarboxylase (GAD65 and GAD67) mRNA in brain areas involved in the addiction circuitry. Ovariectomized, intact and progesterone replacement-treated female rats received saline or cocaine (30 mg/kg, ip) acutely or repeatedly. GAD isoenzyme mRNA levels were determined in the dorsolateral striatum (dSTR) and prefrontal cortex (PFC) by RT-PCR, showing that repeated, but not acute, cocaine decreased GADs/β-actin mRNA ratio in the dSTR irrespective of the hormonal condition (GAD65: P < 0.001; and GAD67: P = 0.004). In the PFC, repeated cocaine decreased GAD65 and increased GAD67 mRNA ratio (P < 0.05). Progesterone replacement decreased both GAD isoenzymes mRNA ratio after acute cocaine in the PFC (P < 0.001) and repeated cocaine treatment reversed this decrease (P < 0.001). These results suggest that cocaine does not immediately affect GAD mRNA expression, while repeated cocaine decreases both GAD65 and GAD67 mRNA in the dSTR of female rats, independently of their hormonal conditions. In the PFC, repeated cocaine increases the expression of GAD isoenzymes, which were decreased due to progesterone replacement.
Resumo:
Estradiol participates in the control of energy homeostasis, as demonstrated by an increase in food intake and in body weight gain after ovariectomy in rats. In the present study, female Wistar rats (200-230 g, N = 5-15 per group), with free access to chow, were individually housed in metabolic cages. We investigated food intake, body weight, plasma leptin levels, measured by specific radioimmunoassay, and the hypothalamic mRNA expression of orexigenic and anorexigenic neuropeptides, determined by real-time PCR, in ovariectomized rats with (OVX+E) and without (OVX) estradiol cypionate treatment (10 µg/kg body weight, sc, for 8 days). Hormonal and mRNA expression were determined at pre-feeding and 4 h after food intake. OVX+E rats showed lower food intake, less body weight gain and lower plasma leptin levels. In the OVX+E group, we also observed a reduction of neuropeptide Y (NPY), agouti-related protein (AgRP) and cocaine- and amphetamine-regulated transcript (CART) mRNA expression in the arcuate nucleus and a decrease in orexin A in the lateral hypothalamic area (LHA). There was an increase in leptin receptor (LepRb), melanocortin-4 receptor (MC4-R), CART, and mainly corticotropin-releasing hormone (CRH) mRNA in the paraventricular nucleus and LepRb and CART mRNA in the LHA. These data show that hypophagia induced by estradiol treatment is associated with reduced hypothalamic expression of orexigenic peptides such as NPY, AgRP and orexin A, and increased expression of the anorexigenic mediators MC4-R, LepRb and CRH. In conclusion, estradiol decreases food intake, and this effect seems to be mediated by peripheral factors such as leptin and the differential mRNA expression of neuropeptides in the hypothalamus.
Resumo:
HTLV-1 Tax expression exerts an inhibitory effect on the Foxp3 transcription factor in CD4+CD25+ T-regulatory cells (Treg). For a better understanding of the role of Tax mRNA in the gene expression of cellular markers we measured Tax, Foxp3, CTLA-4, GITR, TGF-β, and IL-10 mRNA in Treg cells of 50 patients with human T-lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP; 27 women and 23 men; mean age: 56.7 years). The control group consisted of 23 non-infected subjects (12 women and 11 men) with a mean age of 51.3 years. Real-time PCR was used to measure mRNA of Tax proteins and several cellular markers of Treg function. Determinations revealed a high level of Tax mRNA in HAM/TSP (124.35 copies/100 CD4+CD25+ T cells). Foxp3, GITR, and CTLA-4 mRNA levels were lower in HAM/TSP patients (mean ± SD, 22.07 ± 0.78, 9.63 ± 0.36, and 4.54 ± 0.39, respectively) than in non-infected controls (47.15 ± 12.94, 22.14 ± 1.91, and 21.07 ± 2.31). Both groups had similar levels of TGF-β and IL-10. An inverse relationship was found between Tax levels and Foxp3, CTLA-4, and GITR levels. Conversely, there was a direct correlation between levels of Foxp3, GITR, and CTLA-4. Disease severity and evolution time did not correlate with Tax or Foxp3 levels. The present results suggest that Tax and Foxp3 mRNA vary with the same degree of disease severity in HAM/TSP patients. Tax fluctuations may affect CTLA-4 and GITR expression via the Foxp3 pathway, causing virus-induced dysfunction of CD4+CD25+ T cells in HAM/TSP patients.
Resumo:
The actions of thyroid hormone (TH) on pancreatic beta cells have not been thoroughly explored, with current knowledge being limited to the modulation of insulin secretion in response to glucose, and beta cell viability by regulation of pro-mitotic and pro-apoptotic factors. Therefore, the effects of TH on proinsulin gene expression are not known. This led us to measure: a) proinsulin mRNA expression, b) proinsulin transcripts and eEF1A protein binding to the actin cytoskeleton, c) actin cytoskeleton arrangement, and d) proinsulin mRNA poly(A) tail length modulation in INS-1E cells cultured in different media containing: i) normal fetal bovine serum - FBS (control); ii) normal FBS plus 1 µM or 10 nM T3, for 12 h, and iii) FBS depleted of TH for 24 h (Tx). A decrease in proinsulin mRNA content and attachment to the cytoskeleton were observed in hypothyroid (Tx) beta cells. The amount of eEF1A protein anchored to the cytoskeleton was also reduced in hypothyroidism, and it is worth mentioning that eEF1A is essential to attach transcripts to the cytoskeleton, which might modulate their stability and rate of translation. Proinsulin poly(A) tail length and cytoskeleton arrangement remained unchanged in hypothyroidism. T3 treatment of control cells for 12 h did not induce any changes in the parameters studied. The data indicate that TH is important for proinsulin mRNA expression and translation, since its total amount and attachment to the cytoskeleton are decreased in hypothyroid beta cells, providing evidence that effects of TH on carbohydrate metabolism also include the control of proinsulin gene expression.
Resumo:
The objective of the present study was to investigate the effect of leptin on the progression of colorectal carcinoma to metastatic disease by analyzing the serum leptin concentration and Ob-R gene expression in colon cancer tissues. Tissue samples were obtained from 31 patients who underwent surgical resection for colon (18 cases) and metastatic colon (13 cases) cancer. Serum leptin concentration was determined by an enzyme-linked immunosorbent assay (ELISA) and Ob-R mRNA expression by real-time polymerase chain reaction (RT-PCR) for both groups. ELISA data were analyzed by the Student t-test and RT-PCR data were analyzed by the Mann-Whitney U-test. RT-PCR results demonstrated that mRNA expression of Ob-R in human metastatic colorectal cancer was higher than in local colorectal cancer tissues. On the other hand, mean serum leptin concentration was significantly higher in local colorectal cancer patients compared to patients with metastatic colorectal cancer. The results of the present study suggest a role for leptin in the progression of colon cancer to metastatic disease without weight loss. In other words, significantly increased Ob-R mRNA expression and decreased serum leptin concentration in patients with metastatic colon cancer indicate that sensitization to leptin activity may be a major indicator of metastasis to the colon tissue and the determination of leptin concentration and leptin gene expression may be used to aid the diagnosis.
Resumo:
The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (rs=0.283, P=0.049) and serum albumin (rs=0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; rs=-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE.
Resumo:
In DNA vaccines, the gene of interest is cloned into a bacterial plasmid that is engineered to induce protein production for long periods in eukaryotic cells. Previous research has shown that the intramuscular immunization of BALB/c mice with a naked plasmid DNA fragment encoding the Mycobacterium leprae 65-kDa heat-shock protein (pcDNA3-Hsp65) induces protection against M. tuberculosis challenge. A key stage in the protective immune response after immunization is the generation of memory T cells. Previously, we have shown that B cells capture plasmid DNA-Hsp65 and thereby modulate the formation of CD8+ memory T cells after M. tuberculosis challenge in mice. Therefore, clarifying how B cells act as part of the protective immune response after DNA immunization is important for the development of more-effective vaccines. The aim of this study was to investigate the mechanisms by which B cells modulate memory T cells after DNA-Hsp65 immunization. C57BL/6 and BKO mice were injected three times, at 15-day intervals, with 100 µg naked pcDNA-Hsp65 per mouse. Thirty days after immunization, the percentages of effector memory T (TEM) cells (CD4+ and CD8+/CD44high/CD62Llow) and memory CD8+ T cells (CD8+/CD44high/CD62Llow/CD127+) were measured with flow cytometry. Interferon γ, interleukin 12 (IL-12), and IL-10 mRNAs were also quantified in whole spleen cells and purified B cells (CD43−) with real-time qPCR. Our data suggest that a B-cell subpopulation expressing IL-10 downregulated proinflammatory cytokine expression in the spleen, increasing the survival of CD4+ TEM cells and CD8+ TEM/CD127+ cells.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR) using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis habitat and could also be used in other ecological studies.
Resumo:
Visceral leishmaniasis is caused by protozoan parasites of the Leishmania donovani complex. During active disease in humans, high levels of IFN-γ and TNF-α detected in blood serum, and high expression of IFN-γ mRNA in samples of the lymphoid organs suggest that the immune system is highly activated. However, studies using peripheral blood mononuclear cells have found immunosuppression specific to Leishmania antigens; this poor immune response probably results from Leishmania antigen-engaged lymphocytes being trapped in the lymphoid organs. To allow the parasites to multiply, deactivating cytokines IL-10 and TGF-β may be acting on macrophages as well as anti-Leishmania antibodies that opsonize amastigotes and induce IL-10 production in macrophages. These high activation and deactivation processes are likely to occur mainly in the spleen and liver and can be confirmed through the examination of organ samples. However, an analysis of sequential data from studies of visceral leishmaniasis in hamsters suggests that factors outside of the immune system are responsible for the early inactivation of inducible nitric oxide synthase, which occurs before the expression of deactivating cytokines. In active visceral leishmaniasis, the immune system actively participates in non-lymphoid organ lesioning. While current views only consider immunocomplex deposition, macrophages, T cells, cytokines, and immunoglobulins by diverse mechanism also play important roles in the pathogenesis.