125 resultados para isolation-by-barrier


Relevância:

40.00% 40.00%

Publicador:

Resumo:

The aim of the method described here is to remove hemoglobin, the major contaminant in the bovine plasma obtained from slaughterhouses, by adding a mixture of 19% cold ethanol and 0.6% chloroform, followed by fibrinogen and globulin precipitation by the Cohn method and nonspecific hemagglutinin by thermocoagulation. The experimental volume of bovine plasma was 2,000 ml per batch. Final purification was performed by liquid chromatography using the ion-exchange gel DEAE-Sepharose FF. The bovine albumin thus obtained presented > or = 99% purity, a yield of 25.0 ± 1.2 g/l plasma and >71.5% recovery. N-acetyl-DL-tryptophan (0.04 mmol/g protein) and sodium caprylate (0.04 mmol/g protein) were used as stabilizers and the final concentration of albumin was adjusted to 22.0% (w/v), pH 7.2 to 7.3. Viral inactivation was performed by pasteurization for 10 h at 60°C. The bovine albumin for the hemagglutination tests used in immunohematology was submitted to chemical treatment with 0.06% (w/v) glutaraldehyde and 0.1% (w/v) formaldehyde at 37°C for 12 h to obtain polymerization. A change in molecular distribution was observed after this treatment, with average contents of 56.0% monomers, 23.6% dimers, 12.2% trimers and 8.2% polymers. The tests performed demonstrated that this polymerized albumin enhances the agglutination of Rho(D)-positive red cells by anti-Rho(D) serum, permitting and improving visualization of the results.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Availability of analytical standards is a critical aspect in developing methods for quantitative analysis of anthocyanins. The anthocyanins cyanidin-3-O-glucoside and cyanidin-3-O-rutinoside were isolated from samples of freeze-dried açaí (Euterpe oleraceae Mart.), which is a round and purple well-known palm fruit in Brazil, and then used as standards. The isolation of the anthocyanins was performed by High Performance Liquid Chromatography (HPLC), using an adapted six-channel selection valve. The identification of anthocyanin pigments in açaí was based on mass spectrometric data for molecular ions and MS-MS product ions and on previous published data. After the collection procedure, standards with a high purity grade were obtained and an external standard curve of each anthocyanin was plotted.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

During enzymatic process of cheese manufacturing, rennin cleaves κ-casein releasing two fractions: para-κ-casein and glycomacropeptide (GMP), which remains soluble in milk whey. GMP is a peptide with structural particularities such as chain carbohydrates linked to specific threonine residues, to which a great variety of biological activities is attributed. Worldwide cheese production has increased generating high volumes of milk whey that could be efficiently used as an alternative source of high quality peptide or protein in foodstuff formulations. In order to evaluate isolation and recovery on whey GMP by means of thermal treatment (90 °C), 18 samples (2 L each) of sweet whey, resuspended commercial whey (positive control) and acid whey (negative control) were processed. Indirect presence of GMP was verified using chemical tests and PAGE-SDS 15%. At 90 °C treated sweet whey, 14, 20 and 41 kDa bands were observed. These bands may correspond to olygomers of GMP. Peptide recovery showed an average of 1.5 g/L (34.08%). The results indicate that industrial scale GMP production is feasible; however, further research must be carried out for the biological and nutritional evaluation of GMP's incorporation to foodstuff as a supplement.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

There is a trend towards the use of novel technologies nowadays, mainly focused on biological processes, for recycling and the efficient utilization of organic residues that can be metabolized by different microorganisms as a source of energy. In the present study the isolation of bacterial strains from six different agro-industrial by-products and waste was performed with the objective of evaluating their hydrolytic capacities and suitability for use in bioconversion of specific substrates. The 34 isolated strains were screened in specific culture media for the production of various hydrolytic enzymes (lipase, protease, cellulase, and amylase). It was found that 28 strains exhibited proteolytic activity, 18 had lipolytic activity, 13 had caseinolytic activity, 15 had amylolytic activity, and 11 strains exhibited cellulolytic activity. The strains that showed the highest hydrolytic capacities with biotechnological potential were selected, characterized genotipically, and identified as Bacillus, Serratia, Enterococcus, Klebsiella, Stenotrophomonas, Lactococcus, and Escherichia genera. It was concluded that the strain isolates have a high potential for use in the bioconversion of agro-industrial waste, both as a pure culture and as a microbial consortium.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

OBJECTIVE: To evaluate the microbiological quality of pasteurized milk commercialized in Rio de Janeiro, Brazil, and determine serologically enteropathogenic Escherichia coli (EPEC) strains in E. coli isolates obtained from milk samples. METHODS: Ninety samples of pasteurized milk -- types B and C -- of three different commercial brands, purchased in supermarkets and bakeries in Rio de Janeiro, were examined. The amount of total and fecal coliform bacteria was estimated using the Most Probable Number technique. Mesophilic, psychrotrophic, and thermoduric microorganism counts were determined by the Standard Plate Count technique. Isolation and identification of E. coli were carried out using conventional physiological tests. Commercial antisera were used for serological characterization of EPEC. RESULTS: The three milk brands analyzed revealed bacterial counts above the regulated values of the Brazilian government. It was found that among 208 strains of E. coli isolated, 46 (22.1%) were serologically classified as EPEC. The most common EPEC serogroup was O55 (15.2%). CONCLUSIONS: Though recent studies on virulence factors indicate that not all strains serologically classified as EPEC are able to attaching/effacing lesion, it is believed that the isolation of EPEC serogroups from pasteurized milk represent a potential risk for children, as well as an indicative of the presence of other enteropathogens.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A case of acute pulmonary histoplasmosis, where the clinical histoiy and epidemiological data led to the identification of H. capsulatum natural source, is described. Specimens of spleen and liver, obtained after intraperitonial inoculation in mice, grew H. capsulatum in culture from the soil of rural area of General Câmara, by the first time in Rio Grande do Sul.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Crossed immunoelectrophoresis (IEC) was used for detection of free and complexed circulating polisaccharide anodic antigen (AgCA) of Schistosoma mansoni in sera of infected hamsters. An attempt was also done to detect AgCA in human sera from patients infected with S. mansoni. The conditions for isolation and detection of complexed AgCA were established. The sensitivity of IEC was increased by incorporation of 2% polyethylene glicol (PEG) to the agarose and by maintaining the system at 4°C during the electrophoretic run. Free AgCA was detected in 12 and the complexed in 30 of the 37 hamsters sera analysed. Correlation between AgCA (free and complexed) and the parasite load was observed. AgCA was not detected, under the experimental conditions used, in human sera from 7 patients in the acute and 23 in the chronic phase of infection.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In the present study three techniques for obtaining outer membrane enriched fractions from Yersinia pestis were evaluated. The techniques analysed were: differential solubilization of the cytoplasmic membrane with Sarkosyl or Triton X-100, and centrifugation in sucrose density gradients. The sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) of outer membrane isolated by the different methods resulted in similar protein patterns. The measurement of NADH-dehydrogenase and succinate dehydrogenase (inner membrane enzymes) indicated that the outer membrane preparations obtained by the three methods were pure enough for analytical studies. In addition, preliminary evidences on the potential use of outer membrane proteins for the identification of geographic variants of Y. pestis wild isolates are presented.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Authors report an uncommon case of leishmaniasis with disseminated cutaneous lesions, systemic manifestations and ocular involvement, the latter being characterized by bilateral nongranulomatous iridocyclitis. The severity of the oph-thalmologic lesions and its unresponsiveness to therapy (in spite of satisfactory regression of both systemic and cutaneous manifestations) lead to a needle aspiration of the anterior eye chamber, content. From this material Leishmania sp was isolated. To our knowledge this is the first time that Leishmania has been shown into the ocular globe.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The methanol extract of Leptospira interrogans serovar canicola was purified by precipitation with acetone or acetone and chloroform. The antigenicity of the antigen was not altered by heating or treatment with pepsin and pronase. However the antigenicity was lost when the antigen was treated with periodic acid. Chemical analysis revealed the presence of 40% carbohydrate (22% methylpentose, 28%; hexoses),4% protein, 20% lipid and 2,7% phosphate. The complement fixation test with sera from patients with leptospirosis agreed with the microscopic agglutination reaction.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A low cost method (LCM) to produce a gaseous environment for the isolation of Helicobacter pylori, was compared with the standard Gas Park system. The LCM uses a carbonated antacid tablet, a plastic bag with tap water, a candle, and a wide-mouthed glass jar provided with a tight-fitting metalic screw cap and a rubber gasket. Antral gastric biopsies from 153 cases were incubated by duplicate on blood agar plates and treated with the two methods. In 95 cases the agent was isolated from both, and only from the standard method in 10 cases; the opposite condition was found in five cases, and 43 were negative. That difference is not significant (Pearson's X²= 93.25 p > 0,05)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Thirty eight paralysis cases classified as Guillain-Barré syndrome (GBS) in Brazil were analysed. In all these cases Sabin-related poliovirus vaccine strains were isolated. In most of the cases the last vaccine dose was given months or years before the onset of GBS, suggesting a persistent infection or the transmission of the Sabin-related strains to the patients. The isolation of Sabin-related strains from GBS cases some days or weeks after the onset of the disease, demonstrated a temporal association between the isolation of the strains and the disease. Although the isolates from the GBS cases may not be the etiological agent of the disease, this study strongly indicates that infections caused by Sabin-related vaccine strains can trigger the GBS in certain cases.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Diagnostic and parasite characterization and identification studies were carried out in human patients with cutaneous leishmaniasis lesions in Santiago del Estero, Northern Province of Argentina. Diagnostic procedures were biopsies of lesions for smears and inoculations in hamster, needle aspirations of material from ulcers for "in vitro" cultures. Immunodiagnostic techniques applied were IFAT-IgG and Montenegro skin test. Primary isolation of eight stocks of leishmanial parasites was achieved from patients with active lesions. All stocks were biologically characterized by their behaviour in hamster, measurements of amastigote and promastigotes and growth "in vitro". Eight stocks were characterized and identified at species level by their reactivity to a cross-panel of sub-genus and specie-specific Monoclonal Antibodies through an Indirect Immunofluorescence technique and a Dot-ELISA. We conclude from the serodeme analysis of Argentina stocks that: stocks MHOM/AR/92/SE-1; SE-2; SE-4; SE-8; SE-8-I; SE-30; SE-34 and SE-36 are Leishmania (Viannia) braziliensis. Three Leishmania stocks (SE-1; SE-2 and SE-30) did not react with one highly specie-specific Monoclonal Antibody (Clone: B-18, Leishmania (Viannia) braziliensis marker) disclosing two serodeme group patterns. Five out of eight soluble extracts of leishmanial promastigotes were electrophoresed on thin-layer starch gels and examined for the enzyme MPI, Mannose Phosphate Isomerase; MDH, Malate Dehydrogenase; 6PGD, 6 Phosphogluconate Dehydrogenase; NH, Nucleoside Hydrolase, 2-deoxyinosinc as substrate; SOD, Superoxide Dismutase; GPI, Glucose Phosphate Isomerase and ES, Esterase. From the isoenzyme studies we concluded that stocks: MHOM/AR/92/SE-1; SE-2; SE-4; SE-8 and SE-8-I are isoenzymatically Leishmania (Viannia) braziliensis. We need to analyze more enzymes before assigning them to a braziliensis zymodeme.