27 resultados para dmso
Resumo:
OBJETIVOS: avaliar a técnica de criopreservação por vitrificação em DMSO 6 M para oócitos bovinos maturados in vitro e os efeitos do tempo de exposição às soluções de vitrificação (SV). MÉTODOS: estudo experimental tipo coorte. Ovários de bovinos foram obtidos em frigorífico e transportados ao laboratório. Os oócitos foram aspirados. A partir da SV contendo DMSO 6 M (SV 100%), foram preparadas soluções a 25 e 65%. Oócitos foram maturados in vitro por 18-22 horas. Para vitrificação, os oócitos foram colocados em SV 25%, por 5 minutos, transferidos à SV 65%, pipetados em SV 100% para palhetas e estocados em nitrogênio líquido. No primeiro grupo experimental, a exposição à SV 65% tomou até 60 segundos e no segundo grupo não ultrapassou 30 segundos. Para descongelamento, as palhetas foram expostas ao ar por 10 segundos, colocadas em banho-maria por 10 segundos e seu conteúdo expelido e mantido em solução de sacarose por 5 minutos. No terceiro grupo, os oócitos passaram por todas SV menos pelo nitrogênio líquido. Os oócitos recuperados foram inseminados. Para controle, oócitos frescos, maturados in vitro, foram inseminados. RESULTADOS: após vitrificação, foram recuperados 69,1 e 59,8% dos oócitos nos grupos de 30 segundos e 60 segundos, respectivamente, e 24 horas após inseminação pareceram morfologicamente normais 93 e 89,1% deles, respectivamente. No grupo de oócitos expostos às SV sem vitrificação, foram recuperados 75,6%, sendo 84,6% destes viáveis 24 horas após inseminação. Não ocorreu fertilização nos grupos experimentais. Entre os controles frescos, foram fertilizados 65,4% dos oócitos. CONCLUSÕES: a técnica de vitrificação utilizando DMSO 6 M não é aplicável para criopreservação de oócitos bovinos maturados in vitro. A redução do tempo de exposição às SV não superou o efeito deletério sobre a capacidade fertilizadora dos oócitos. Aprimoramentos da técnica são necessários para proteção da zona pelúcida e do oolema.
Resumo:
As características tridimensionais dos componentes intracelulares de células acinares e de ductos foram reveladas usando o método ósmio-DMSO-ósmio. As amostras foram maceradas em solução de tetróxido de ósmio diluído após a fratura na solução de dimetil sulfoxido. As lamelas do retículo endoplasmático granular são reveladas entremeadas por várias mitocôndrias. As lamelas do retículo endoplasmático granular são localizados ao redor dos núcleos na porção basal e estas estruturas são observadas em imagens tridimensionais de microscopia eletrônica de alta resolução.
Resumo:
The objective of this study was to evaluate the effect of the ethanolic extract of Serjania lethalis leaves and stems on the diaspore germination and seedling growth of wild poinsettia (Euphorbia heterophylla) and barnyardgrass (Echinochloa crus-galli). The crude ethanolic extract was prepared from 100 g of dry plant material dissolved in 500 ml of ethanol. The extracts were solubilized in a buffer solution containing dimethyl sulfoxide (DMSO) at concentrations of 10.0, 7.5, 5.0 and 2.5 mg mL-1. The effect of these extracts was compared with herbicide oxyfluorfen in bioassays. The ethanolic extracts of S. lethalis leaves and stems inhibited the germination and seedling growth of barnyardgrass and wild poinsettia in a concentration-dependent manner. The reduction in the root length of E. heterophylla seedlings might be attributed to the reduced elongation of metaxylem cells. The phytotoxicity of the extracts ranged according to the receptor species, and for some variables, the inhibitory effect was similar, and even superior, to that of the commercial herbicide. Thus, S. lethalis extracts might be a promising alternative for sustainable weed management.
Resumo:
To investigate the behavioral effects of different vehicles microinjected into the dorsal periaqueductal grey (DPAG) of male Wistar rats, weighing 200-250 g, tested in the elevated plus maze, animals were implanted with cannulas aimed at this structure. One week after surgery the animals received microinjections into the DPAG of 0.9% (w/v) saline, 10% (v/v) dimethyl sulfoxide (DMSO), 2% (v/v) Tween-80, 10% (v/v) propylene glycol, or synthetic cerebrospinal fluid (CSF). Ten min after the injection (0.5 µl) the animals (N = 8-13/group) were submitted to the elevated plus maze test. DMSO significantly increased the number of entries into both the open and enclosed arms when compared to 0.9% saline (2.7 ± 0.8 and 8.7 ± 1.3 vs 0.8 ± 0.3 and 5.1 ± 0.9, respectively, Duncan test, P<0.05), and tended to increase enclosed arm entries as compared to 2% Tween-80 (8.7 ± 1.3 vs 5.7 ± 0.9, Duncan test, P<0.10). In a second experiment no difference in plus maze exploration was found between 0.9% saline- or sham-injected animals (N = 11-13/group). These results indicate that intra-DPAG injection of some commonly used vehicles such as DMSO, saline or Tween-80 affects the exploratory activity of rats exposed to the elevated plus maze in statistically different manners
Resumo:
Niemann-Pick type C (NPC) fibroblasts present a large concentration of cholesterol in their cytoplasm due to a still unidentified deficiency in cholesterol metabolism. The influence of dimethylsulfoxide (DMSO) on the amount of intracellular cholesterol was measured in 8 cultures of normal fibroblasts and in 7 fibroblast cultures from NPC patients. DMSO was added to the fibroblast cultures at three different concentrations (1, 2 and 4%, v/v) and the cultures were incubated for 24 h. Sphingomyelinase activity was significantly increased in both groups of cells only when incubated with 2% DMSO (59.4 ± 9.1 and 77.0 ± 9.1 nmol h-1 mg protein-1, controls without and with 2% DMSO, respectively; 47.7 ± 5.2 and 55.8 ± 4.1 nmol h-1 mg protein-1, NPC without and with 2% DMSO, respectively). However, none of the DMSO concentrations used altered the amount of cholesterol in the cytoplasm of NPC cells (0.704 ± 0.049, 0.659 ± 0.041, 0.688 ± 0.063 and 0.733 ± 0.088 mg/mg protein, without DMSO, 1% DMSO, 2% DMSO and 4% DMSO, respectively). This finding suggests that sphingomyelinase deficiency is a secondary defect in NPC and shows that DMSO failed to remove the stored cholesterol. These data do not support the use of DMSO in the treatment of NPC patients.
Resumo:
Cells usually lose adhesion and increase proliferation and migration during malignant transformation. Here, we studied how proliferation can affect the other two characteristics, which ultimately lead to invasion and metastasis. We determined the expression of ß1 integrins, as well as adhesion and migration towards laminin-1, fibronectin, collagens type I and type IV presented by LISP-1 colorectal cancer cells exposed to 2.5% dimethyl sulfoxide (DMSO), an agent capable of decreasing proliferation in this poorly differentiated colorectal cell line. Untreated cells (control), as shown by flow cytometry and monoclonal antibodies, expressed alpha2 (63.8 ± 11.3% positive cells), alpha3 (93.3 ± 7.0%), alpha5 (50.4 ± 12.0%) and alpha6 (34.1 ± 4.9%) integrins but not alpha1, alpha4, alphav or ß4. Cells adhered well to laminin-1 (73.4 ± 6.0%) and fibronectin (40.0 ± 2.0%) substrates but very little to collagens. By using blocking monoclonal antibodies, we showed that alpha2, alpha3 and alpha6 mediated laminin-1 adhesion, but neither alpha3 nor alpha5 contributed to fibronectin adherence. DMSO arrested cells at G0/G1 (control: 55.0 ± 2.4% vs DMSO: 70.7 ± 2.5%) while simultaneously reducing alpha5 (24.2 ± 19%) and alpha6 (14.3 ± 10.8%) expression as well as c-myc mRNA (7-fold), the latter shown by Northern blotting. Although the adhesion rate did not change after exposure to DMSO, alpha3 and alpha5 played a major role in laminin-1 and fibronectin adhesion, respectively. Migration towards laminin-1, which was clearly increased upon exposure to DMSO (control: 6 ± 2 cells vs DMSO: 64 ± 6 cells), was blocked by an antibody against alpha6. We conclude that the effects of DMSO on LISP-1 proliferation were accompanied by concurrent changes in the expression and function of integrins, consequently modulating adhesion/migration, and revealing a complex interplay between function/expression and the proliferative state of cells.
Resumo:
The pathogenesis of nonsteroidal anti-inflammatory drug (NSAID) enteropathy is a complex process involving the uncoupling of mitochondrial oxidative phosphorylation and inhibition of cyclooxygenase (COX). Rofecoxib, a selective inhibitor of COX-2, has shown less gastric damage, but the same beneficial effect is not clear in the case of the small bowel. Fifty-seven male Wistar rats (250-350 g) were divided into three groups (N = 19 each) to evaluate the effect of this NSAID on the rat intestine. The groups received 2.5 mg/kg rofecoxib, 7.5 mg/kg indomethacin or water with 5% DMSO (control) given as a single dose by gavage 24 h before the beginning of the experiment. A macroscopic score was used to quantify intestinal lesions and intestinal permeability was measured using [51Cr]-ethylenediaminetetraacetic acid ([51Cr]-EDTA). The extent of intestinal lesion, indicated by a macroscopic score, was significantly lower when rofecoxib was administered compared to indomethacin (rofecoxib = 0.0 vs indomethacin = 63.6 ± 25.9; P < 0.05) and did not differ from control. The intestinal permeability to [51Cr]-EDTA was significantly increased after indomethacin (control = 1.82 ± 0.4 vs indomethacin = 9.12 ± 0.8%; P < 0.0001), but not after rofecoxib, whose effect did not differ significantly from control (control = 1.82 ± 0.4 vs rofecoxib = 2.17 ± 0.4%; ns), but was significantly different from indomethacin (indomethacin = 9.12 ± 0.8 vs rofecoxib = 2.17 ± 0.4%; P < 0.001). In conclusion, the present data show that rofecoxib is safer than indomethacin in rats because it does not induce macroscopic intestinal damage or increased intestinal permeability.
Resumo:
Scutellaria baicalensis Georgi is one of the important medicinal herbs widely used for the treatment of various inflammatory diseases in Asia. Baicalin (BA) is a bioactive anti-inflammatory flavone found abundantly in Scutellaria baicalensis Georgi. To explore the therapeutic potential of BA, we examined the effects of systemic administration of the flavone (5 and 10 mg/kg, ip) on relapsing/remitting experimental autoimmune encephalomyelitis (EAE) induced by proteolipid protein 139-151 in SJL/J mice, an experimental model of multiple sclerosis. The mice treated with PBS or BA at day -1 and for 3 consecutive days were observed daily for clinical signs of disease up to 60 days after immunization. In the PBS-EAE group, neurological scores were: incidence (100%), mean day of onset (8.0 ± 0.73), peak clinical score (3.0 ± 0.4), and cumulative disease index (141.8 ± 19.4). In the BA-EAE group (5 or 10 mg kg-1 day-1, respectively), incidence (95 or 90%), mean day of onset (9.0 ± 0.80 or 9.2 ± 0.75; P = 0.000), peak clinical score (2.2 ± 0.3 or 2.0 ± 0.3; P = 0.000), and cumulative disease index (75.9 ± 10.1 or 62.9 ± 8.4; P = 0.000) decreased, accompanied by the histopathological findings (decrease of dense mononuclear infiltration surrounding vascellum) for the spinal cord. Additionally, the in vitro effects of BA (5, 10, and 25 µM) on mononuclear cells collected from popliteal and inguinal lymph nodes of day-10 EAE mice were evaluated using an MTT reduction assay for cell proliferation, and ELISA to measure IFN-g and IL-4 cytokines. Compared with the control group, BA caused an increase in IL-4 (EAE-DMSO: 3.56 ± 0.42 pg/mL vs EAE-BA (5, 10, and 25 µM): 6.03 ± 1.1, 7.83 ± 0.65, 10.54 ± 1.13 pg/mL, respectively; P < 0.001); but inhibited IFN-g (EAE-DMSO: 485.76 ± 25.13 pg/mL vs EAE-BA (5, 10, and 25 µM): 87.08 ± 9.24, 36.27 ± 5.44, 19.18 ± 2.93 pg/mL, respectively; P < 0.001) and the proliferation of mononuclear cells (EAE-DMSO: 0.73 ± 0.021 vs EAE-BA (5, 10, and 25 µM): 0.41 ± 0.015, 0.31 ± 0.018, 0.21 ± 0.11, respectively; P < 0.001) in a concentration-dependent manner. The results suggest that BA might be effective in the treatment of multiple sclerosis.
Resumo:
The JAK2/STAT3 signal pathway is an important component of survivor activating factor enhancement (SAFE) pathway. The objective of the present study was to determine whether the JAK2/STAT3 signaling pathway participates in hydrogen sulfide (H2S) postconditioning, protecting isolated rat hearts from ischemic-reperfusion injury. Male Sprague-Dawley rats (230-270 g) were divided into 6 groups (N = 14 per group): time-matched perfusion (Sham) group, ischemia/reperfusion (I/R) group, NaHS postconditioning group, NaHS with AG-490 group, AG-490 (5 µM) group, and dimethyl sulfoxide (DMSO; <0.2%) group. Langendorff-perfused rat hearts, with the exception of the Sham group, were subjected to 30 min of ischemia followed by 90 min of reperfusion after 20 min of equilibrium. Heart rate, left ventricular developed pressure (LVDP), left ventricular end-diastolic pressure (LVEDP), and the maximum rate of increase or decrease of left ventricular pressure (± dp/dt max) were recorded. Infarct size was determined using triphenyltetrazolium chloride (TTC) staining. Myocardial TUNEL staining was used as the in situ cell death detection method and the percentage of TUNEL-positive nuclei to all nuclei counted was used as the apoptotic index. The expression of STAT3, bcl-2 and bax was determined by Western blotting. After reperfusion, compared to the I/R group, H2S significantly improved functional recovery and decreased infarct size (23.3 ± 3.8 vs 41.2 ± 4.7%, P < 0.05) and apoptotic index (22.1 ± 3.6 vs 43.0 ± 4.8%, P < 0.05). However, H2S-mediated protection was abolished by AG-490, the JAK2 inhibitor. In conclusion, H2S postconditioning effectively protects isolated I/R rat hearts via activation of the JAK2/STAT3 signaling pathway.
Resumo:
The N-acylhydrazone (NAH) analogues N-methyl 2-thienylidene 3,4-benzoylhydrazine (LASSBio-785) and N-benzyl 2-thienylidene 3,4-benzoylhydrazine (LASSBio-786) were prepared from 2-thienylidene 3,4-methylenedioxybenzoylhydrazine (LASSBio-294). The ability of LASSBio-785 and LASSBio-786 to decrease central nervous system activity was investigated in male Swiss mice. LASSBio-785 or LASSBio-786 (30 mg/kg, ip) reduced locomotor activity from 209 ± 26 (control) to 140 ± 18 (P < 0.05) or 146 ± 15 crossings/min (P < 0.05), respectively. LASSBio-785 (15 or 30 mg/kg, iv) also reduced locomotor activity from 200 ± 15 to 116 ± 29 (P < 0.05) or 60 ± 16 crossings/min (P < 0.01), respectively. Likewise, LASSBio-786 (15 or 30 mg/kg, iv) reduced locomotor activity from 200 ± 15 to 127 ± 10 (P < 0.01) or 96 ± 14 crossings/min (P < 0.01), respectively. Pretreatment with flumazenil (20 mg/kg,ip) prevented the locomotor impairment induced by NAH analogues (15 mg/kg, iv), providing evidence that the benzodiazepine (BDZ) receptor is involved. This finding was supported by the structural similarity of NAH analogues to midazolam. However, LASSBio-785 showed weak binding to the BDZ receptor. LASSBio-785 or LASSBio-786 (30 mg/kg,ip, n = 10) increased pentobarbital-induced sleeping time from 42 ± 5 (DMSO) to 66 ± 6 (P < 0.05) or 75 ± 4 min (P < 0.05), respectively. The dose required to achieve 50% hypnosis (HD50) following iv injection of LASSBio-785 or LASSBio-786 was 15.8 or 9.5 mg/kg, respectively. These data suggest that both NAH analogues might be useful for the development of new neuroactive drugs for the treatment of insomnia or for use in conjunction with general anesthesia.
Resumo:
A extração de pigmentos carotenóides constitui uma possível alternativa, de grande agregação de valor, para o aproveitamento da cabeça do camarão Litopenaeus vannamei. O objetivo do presente trabalho foi a identificação, a extração e a quantificação dos principais pigmentos desta matéria-prima, coletados a partir de uma planta de beneficiamento de camarão no Ceará - Brasil. Após cocção dos resíduos a 100 °C, na proporção 1:2 cabeça de camarão e água durante 15 minutos, obteve-se uma pasta de pigmentos brutos extraindo-se os carotenóides com acetona resfriada e, posteriormente, com hexano, obtendo a fase pigmento-hexano. Obteve-se também a fase DMSO, após o material ser particionado com dimetilsulfóxido, e uma fração acidificada. Estas frações sofreram evaporação e secagem, sendo os carotenóides identificados em coluna aberta, utilizando-se o parâmetro de eluição das frações, o espectro de absorção visível e o valor de Rf na camada delgada de sílica gel. Os espectros de absorção de cada fração foram obtidos a 350 a 550 nm e quantificados por cromatografia de camada delgada. Para o cálculo de carotenóides totais (37,62 µg.g-1 da pasta de pigmentos), utilizou-se o somatório das frações hexano, DMSO e acidificada, e coeficientes de extinção 2592, 2100 e 1690 referentes ao beta-caroteno, astaxantina e astaceno, respectivamente. A astaxantina foi o pigmento mais abundante (45,5%), seguido do beta-caroteno-5,6-epóxido (33,5%) e do astaceno (21,0%).
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.