25 resultados para asymmetry, ground reaction forces, barrier clearance, within foot loading


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Over the last 20 years, there has been an increase in the number of leishmaniasis cases in Brazil. Belo Horizonte (BH) is one of the most highly populated Brazilian cities that is affected by visceral leishmaniasis (VL). The health services in BH are coordinated by a central nucleus that is subdivided into nine sanitary districts. Historically, the highest level of human VL cases was found in the northeast sanitary district (NSD). The objective of our study was to detect Leishmania infection in the phlebotomine sand flies collected in the NSD by dissection and molecular approaches. Following the occurrence of human VL cases in 2005, entomological captures were performed from July 2006-June 2007. Out of the 245 sand flies dissected, only three Lutzomyia longipalpis spp contained flagellates. The female sand flies were grouped into 120 pools according to date, collection site and species, with approximately 10 individual sand flies in each pool. Subsquently, the DNA was extracted and Leishmania spp and other parasites were detected and identified by polymerase chain reaction (PCR) and PCR-restriction fragment length polymorfism. Leishmania infantum was present in at least 19% of the Lu. longipalpis collected, in 3.8% of the Nyssomiya whitmani collected, in 33.3% of the Evandromiya termitophila collected and in 14.3% of the Nyssomiya intermedia collected. When the females of the cortelezzii complex were compared with each other, 3.2% of the females were infected with Leishmania braziliensis, whereas 3.2% of the females were infected with trypanosomatids.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A single polymerase chain reaction (PCR) reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM) strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruziI to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b), t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA) on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

An unusually high incidence of microcephaly in newborns has recently been observed in Brazil. There is a temporal association between the increase in cases of microcephaly and the Zika virus (ZIKV) epidemic. Viral RNA has been detected in amniotic fluid samples, placental tissues and newborn and fetal brain tissues. However, much remains to be determined concerning the association between ZIKV infection and fetal malformations. In this study, we provide evidence of the transplacental transmission of ZIKV through the detection of viral proteins and viral RNA in placental tissue samples from expectant mothers infected at different stages of gestation. We observed chronic placentitis (TORCH type) with viral protein detection by immunohistochemistry in Hofbauer cells and some histiocytes in the intervillous spaces. We also demonstrated the neurotropism of the virus via the detection of viral proteins in glial cells and in some endothelial cells and the observation of scattered foci of microcalcifications in the brain tissues. Lesions were mainly located in the white matter. ZIKV RNA was also detected in these tissues by real-time-polymerase chain reaction. We believe that these findings will contribute to the body of knowledge of the mechanisms of ZIKV transmission, interactions between the virus and host cells and viral tropism.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

ABSTRACT The population dynamics of a species tends to change from the core to the periphery of its distribution. Therefore, one could expect peripheral populations to be subject to a higher level of stress than more central populations (the center–periphery hypothesis) and consequently should present a higher level of fluctuating asymmetry. To test these predictions we study asymmetry in wing shape of five populations of Drosophila antonietae collected throughout the distribution of the species using fluctuating asymmetry as a proxy for developmental instability. More specifically, we addressed the following questions: (1) what types of asymmetry occur in populations of D. antonietae? (2) Does the level of fluctuating asymmetry vary among populations? (3) Does peripheral populations have a higher fluctuating asymmetry level than central populations? We used 12 anatomical landmarks to quantify patterns of asymmetry in wing shape in five populations of D. antonietae within the framework of geometric morphometrics. Net asymmetry – a composite measure of directional asymmetry + fluctuating asymmetry – varied significantly among populations. However, once net asymmetry of each population is decomposed into directional asymmetry and fluctuating asymmetry, most of the variation in asymmetry was explained by directional asymmetry alone, suggesting that populations of D. antonietae have the same magnitude of fluctuating asymmetry throughout the geographical distribution of the species. We hypothesize that larval development in rotting cladodes might play an important role in explaining our results. In addition, our study underscores the importance of understanding the interplay between the biology of a species and its geographical patterns of asymmetry.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Carbon monoxide (CO) is a pollutant commonly recognized for its toxicological attributes, including CNS and cardiovascular effects. But CO is also formed endogenously in mammalian tissues. Endogenously formed CO normally arises from heme degradation in a reaction catalyzed by heme oxygenase. While inhibitors of endogenous CO production can raise arterial pressure, heme loading can enhance CO production and lead to vasodepression. Both central and peripheral tissues possess heme oxygenases and generate CO from heme, but the inability of heme substrate to cross the blood brain barrier suggests the CNS heme-heme oxygenase-CO system may be independent of the periphery. In the CNS, CO apparently acts in the nucleus tractus solitarii (NTS) promoting changes in glutamatergic neurotransmission and lowering blood pressure. At the periphery, the heme-heme oxygenase-CO system can affect cardiovascular functions in a two-fold manner; specifically: 1) heme-derived CO generated within vascular smooth muscle (VSM) can promote vasodilation, but 2) its actions on the endothelium apparently can promote vasoconstriction. Thus, it seems reasonable that the CNS-, VSM- and endothelial-dependent actions of the heme-heme oxygenase-CO system may all affect cardiac output and vascular resistance, and subsequently blood pressure.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We recently demonstrated that automatic attention favors the right side of space and, in the present study, we investigated whether voluntary attention also favors this side. Six reaction time experiments were conducted. In each experiment, 12 new 18-25-year-old male right-handed individuals were tested. In Experiments 1, 2, 3 (a, b) and 4 (a, b), tasks with increasing attentional demands were used. In Experiments 1, 2, 3a, and 4a, attention was oriented to one or both sides by means of a central spatially informative visual cue. A left or right side visual target appeared 100, 300, or 500 ms later. Attentional effects were observed in the four experiments. In Experiments 2, 3a and 4a, these effects were greater when the cue indicated the right side than when it indicated the left side (respectively: 16 ± 10 and 44 ± 6 ms, P = 0.015, for stimulus onset asynchrony of 500 ms in Experiment 2; 38 ± 10 and 70 ± 7 ms, P = 0.011, for Experiment 3a, and 23 ± 11 and 61 ± 10 ms, P = 0.009, for Experiment 4a). In Experiments 3b and 4b, the central cue pointed to both sides and was said to be non-relevant for task performance. In these experiments right and left reaction times did not differ. The most conservative interpretation of the present findings is that voluntary attention orienting favors the right side of space, particularly when a difficult task has to be performed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

There is evidence that the left hemisphere is more competent for motor control than the right hemisphere. This study investigated whether this hemispheric asymmetry is expressed in the latency/duration of sequential responses performed by the left and/or right hands. Thirty-two right-handed young adults (16 males, 16 females; 18-25 years old) were tested in a simple or choice reaction time task. They responded to a left and/or right visual target by moving their left and/or right middle fingers between two keys on each side of the midline. Right hand reaction time did not differ from left hand reaction time. Submovement times were longer for the right hand than the left hand when the response was bilateral. Pause times were shorter for the right hand than the left hand, both when the responses were unilateral or bilateral. Reaction time results indicate that the putatively more efficient response preparation by the left hemisphere motor mechanisms is not expressed behaviorally. Submovement time and pause time results indicate that the putatively more efficient response execution by the left hemisphere motor mechanisms is expressed behaviorally. In the case of the submovements, the less efficient motor control of the left hand would be compensated by a more intense attention to this hand.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coffee is one of the most appreciated drinks in the world. Coffee ground is obtained from the fruit of a small plant that belongs to the genus Coffea. Coffea arabica and Coffea canephora robusta are the two most commercially important species. They are more commonly known as arabica and robusta, respectively. Two-thirds of Coffea arabica plants are grown in South and Central America, and Eastern Africa - the place of origin for this coffee species. Contamination by microorganisms has been a major matter affecting coffee quality in Brazil, mainly due to the harvesting method adopted. Brazilian harvests are based on fruits collected from the ground mixed with those that fall on collection cloths. As the Bacillus cereus bacterium frequently uses the soil as its environmental reservoir, it is easily capable of becoming a contaminant. This study aimed to evaluate the contamination and potential of B. cereus enterotoxin genes encoding the HBL and NHE complexes, which were observed in strains of ground and roasted coffee samples sold in Rio de Janeiro. The PCR (Polymerase Chain Reaction) results revealed high potential of enterotoxin production in the samples. The method described by Speck (1984) was used for the isolation of contaminants. The investigation of the potential production of enterotoxins through isolates of the microorganism was performed using the B. cereus enterotoxin Reverse Passive Latex Agglutination test-kit (BCET-RPLA, Oxoid), according to the manufacturer's instructions. The potential of enterotoxin production was investigated using polymerase chain reaction (PCR) methods for hblA, hblD and hblC genes (encoding hemolysin HBL) and for nheA, nheB and nheC genes (encoding non-hemolytic enterotoxin - NHE). Of all the 17 strains, 100% were positive for at least 1 enterotoxin gene; 52.9% (9/17) were positive for the 3 genes encoding the HBL complex; 35.3% (6/17) were positive for the three NHE encoding genes; and 29.4% (5/17) were positive for all enterotoxic genes.