75 resultados para WHOLE HUMAN SKIN
Resumo:
INTRODUCTION: The innate immune response is the first mechanism of protection against Trypanosoma cruzi, and the interaction of inflammatory cells with parasite molecules may activate this response and modulate the adaptive immune system. This study aimed to analyze the levels of cytokines and chemokines synthesized by the whole blood cells (WBC) and peripheral blood mononuclear cells (PBMC) of individuals seronegative for Chagas disease after interaction with live T. cruzi trypomastigotes. METHODS: IL-12, IL-10, TNF-α, TGF-β, CCL-5, CCL-2, CCL-3, and CXCL-9 were measured by ELISA. Nitrite was determined by the Griess method. RESULTS: IL-10 was produced at high levels by WBC compared with PBMC, even after incubation with live trypomastigotes. Production of TNF-α by both PBMC and WBC was significantly higher after stimulation with trypomastigotes. Only PBMC produced significantly higher levels of IL-12 after parasite stimulation. Stimulation of cultures with trypomastigotes induced an increase of CXCL-9 levels produced by WBC. Nitrite levels produced by PBMC increased after the addition of parasites to the culture. CONCLUSIONS: Surface molecules of T. cruzi may induce the production of cytokines and chemokines by cells of the innate immune system through the activation of specific receptors not evaluated in this experiment. The ability to induce IL-12 and TNF-α contributes to shift the adaptive response towards a Th1 profile.
Resumo:
To evaluate the effect of BCG vaccination and T lymphocyte subpopulations on the reactivity to the tuberculin skin test, 113 asymtomatic HIV+ individuals were tuberculin tested by intradermal injection of 5TU of purified protein derivative and the levels of circulating lymphocyte (CD3, CD4 and CD8) subpopulations determined by indirect immunofluorescence. Ninety-two percent of the subjects included in the study were males. The mean age of the group was 32.1±7.4 years. Sixty-two percent presented a BCG scar. However, only 22% exhibited positive tuberculin reactions (³5mm) irrespective of the presence of the BCG scar. Tuberculin positive individuals exhibited higher CD4+ cell counts (p=0.004) and CD4+/CD8+ ratios (p=0.006) than tuberculin negative (<5mm) HIV+ individuals. The number of individuals with positive tuberculin reactions was significantly higher in subjects with more than 500 CD4+ lymphocytes/ml (p=0.02) or CD4+/CD8+ ratios ³1.12 (p=0.002). These results suggest that a prior BCG vaccination does not influence the reactivity to the tuberculin skin test in HIV+ asymptomatic individuals and that the number of CD4+ lymphocytes and the CD4+/CD8+ ratio positively correlate with the tuberculin reactivity
Resumo:
Localised cutaneous leishmaniasis (LCL) is the most common form of cutaneous leishmaniasis characterised by single or multiple painless chronic ulcers, which commonly presents with secondary bacterial infection. Previous culture-based studies have found staphylococci, streptococci, and opportunistic pathogenic bacteria in LCL lesions, but there have been no comparisons to normal skin. In addition, this approach has strong bias for determining bacterial composition. The present study tested the hypothesis that bacterial communities in LCL lesions differ from those found on healthy skin (HS). Using a high throughput amplicon sequencing approach, which allows for better populational evaluation due to greater depth coverage and the Quantitative Insights Into Microbial Ecology pipeline, we compared the microbiological signature of LCL lesions with that of contralateral HS from the same individuals.Streptococcus, Staphylococcus,Fusobacterium and other strict or facultative anaerobic bacteria composed the LCL microbiome. Aerobic and facultative anaerobic bacteria found in HS, including environmental bacteria, were significantly decreased in LCL lesions (p < 0.01). This paper presents the first comprehensive microbiome identification from LCL lesions with next generation sequence methodology and shows a marked reduction of bacterial diversity in the lesions.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
The occurrence of secondary cell mediated immune response (CMI) in human antirabies immunization was studied. The Puenzalida & Palácios vaccine was used because it is routinely used in Brazil. CMI was evaluated by lymphoblastic transformation indices obtained in whole blood culture in the presence of rabies and control (nervous tissue) antigens. Eleven volunteers submitted to revaccination constituted the group under study, while three other volunteers submitted primo vaccination were utilized as control group. A clear secondary CMI to rabies antigen was detected in all the revaccinated volunteers who showed earlier and more intense response than the control group. Response to the control antigen, however, present in all the components of the first group was not detectable in two out of the three primovaccinated and very low in the third one.
Resumo:
The present study evaluates the humoral and cellular immune responses in 35 volunteers submited to short antirabies vaccination schedules with the Fuenzalida & Palacios vaccine based on the administration of doses on non consecutive days. The volunteers were divided into two groups. The first group received a total number of five doses given on days 0, 4, 7, 20 and 35. The other group received four doses, the first one being a double dose given on day 0 and than three other single doses on days 7, 20 and 35. The evaluation of humoral immune response was carried out by serum neutralization (SN) and indirect immunofluorescense (IIF) tests, while the cellular immune response was evaluated by lymphoblastic transformation assay (LTA) and skin test (ST). According to our results these reduced schedules elicited early and effective humoral and cellulafimmune responses to rabies antigen suggesting that new reduced schedules should be extensively studied in order to give the proper bases to the proposition of changes in the current long-term schedule.
Resumo:
Recent human herpesvirus 6 (HHV-6) infection was detected in cases of exanthem subitum (ES) involving four children, aged 10 to 24 months, between April and August 1994, in Belém, Brazil. By using the indirect immunofluorescence antibody assay (IFA), significant increases (at least eight times) in antibody concentrations were noted from the acute to the convalescent serum samples, with titers ranging from <1:10/1:80 to <1:10/1:640 (patients 3 and 2, respectively). All children had high fever (over 39ºC) for three days, followed by generalized, maculo-papular skin rash. A physical examination of the children also revealed concomitant, cervical lymph node swelling and tonsillar pharyngitis in two of them.
Resumo:
Diagnostic and parasite characterization and identification studies were carried out in human patients with cutaneous leishmaniasis lesions in Santiago del Estero, Northern Province of Argentina. Diagnostic procedures were biopsies of lesions for smears and inoculations in hamster, needle aspirations of material from ulcers for "in vitro" cultures. Immunodiagnostic techniques applied were IFAT-IgG and Montenegro skin test. Primary isolation of eight stocks of leishmanial parasites was achieved from patients with active lesions. All stocks were biologically characterized by their behaviour in hamster, measurements of amastigote and promastigotes and growth "in vitro". Eight stocks were characterized and identified at species level by their reactivity to a cross-panel of sub-genus and specie-specific Monoclonal Antibodies through an Indirect Immunofluorescence technique and a Dot-ELISA. We conclude from the serodeme analysis of Argentina stocks that: stocks MHOM/AR/92/SE-1; SE-2; SE-4; SE-8; SE-8-I; SE-30; SE-34 and SE-36 are Leishmania (Viannia) braziliensis. Three Leishmania stocks (SE-1; SE-2 and SE-30) did not react with one highly specie-specific Monoclonal Antibody (Clone: B-18, Leishmania (Viannia) braziliensis marker) disclosing two serodeme group patterns. Five out of eight soluble extracts of leishmanial promastigotes were electrophoresed on thin-layer starch gels and examined for the enzyme MPI, Mannose Phosphate Isomerase; MDH, Malate Dehydrogenase; 6PGD, 6 Phosphogluconate Dehydrogenase; NH, Nucleoside Hydrolase, 2-deoxyinosinc as substrate; SOD, Superoxide Dismutase; GPI, Glucose Phosphate Isomerase and ES, Esterase. From the isoenzyme studies we concluded that stocks: MHOM/AR/92/SE-1; SE-2; SE-4; SE-8 and SE-8-I are isoenzymatically Leishmania (Viannia) braziliensis. We need to analyze more enzymes before assigning them to a braziliensis zymodeme.
Resumo:
An epizootic outbreak of rabies occurred in 1995 in Ribeirão Preto, SP, with 58 cases of animal rabies (54 dogs, 3 cats and 1 bat) confirmed by the Pasteur Institute of São Paulo, and one human death. The need to provide care to a large number of people for the application of equine rabies immune globulin (ERIG) prevented the execution of the skin sensitivity test (SST) and often also the execution of desensitization, procedures routinely used up to that time at the Emergency Unit of the University Hospital of the Faculty of Medicine of Ribeirão Preto, University of São Paulo (EU-UHFMRP-USP), a reference hospital for the application of heterologous sera. In view of our positive experience of several years with the abolition of SST and of the use of premedication before the application of antivenom sera, we used a similar schedule for ERIG application. Of the 1489 victims of animal bites, 1054 (71%) received ERIG; no patient was submitted to SST and all received intravenously anti-histamines (anti-H1 + anti-H2) and corticosteroids before the procedure. The patients were kept under observation for 60 to 180 minutes and no adverse reaction was observed. On the basis of these results, since December 1995 ERIG application has been decentralized in Ribeirão Preto and has become the responsibility of the Emergency Unit of the University Hospital and the Central Basic Health Unit, where the same routine is used. Since then, 4216 patients have received ERIG (1818 at the Basic Health Unit and 2398 at the EU-UHFMRP), with no problems. The ideal would be the routine use of human rabies immune globulin (HRIG) in public health programs, but this is problematic, because of their high cost. However, while this does not occur, the use of SST is no longer justified at the time of application of ERIG, in view of the clinical evidence of low predictive value and low sensitivity of SST involving the application of heterologous sera. It is very important to point out that a negative SST result may lead the health team to a feeling of false safety that no adverse reaction will occur, but this is not true for the anaphylactoid reactions. The decision to use premedication, which is based on knowledge about anaphylaxis and on the pharmacology of the medication used, is left to the judgment of health professionals, who should always be prepared for eventual untoward events.
Resumo:
Cerebral phaeohyphomycosis ("chromoblastomycosis") is a rare intracranial lesion. We report the first human culture-proven case of brain abscesses due to Fonsecaea pedrosoi in Brazil. The patient, a 28 year-old immunocompetent white male, had ocular manifestations and a hypertensive intracranial syndrome. Magnetic resonance imaging (MRI) of the brain revealed a main tumoral mass involving the right temporo-occipital area and another smaller apparently healed lesion at the left occipital lobe. A cerebral biopsy was performed and the pathological report was cerebral chromoblastomycosis. The main lesion was enucleated surgically and culture of the necrotic and suppurative mass grew a fungus identified as Fonsecaea pedrosoi. The patient had received a knife wound sixteen years prior to his hospitalization and, more recently, manifested a pulmonary granulomatous lesion in the right lung with a single non-pigmented form of a fungus present. It was speculated that the fungus might have gained entrance to the host through the skin lesion, although a primary respiratory lesion was not excluded. The patient was discharged from the hospital still with ocular manifestations and on antimycotic therapy and was followed for eight months without disease recurrence. Few months after he had complications of the previous neuro-surgery and died. A complete autopsy was performed and no residual fungal disease was found.
Resumo:
We screened sera from 370 patients suffering from exanthematous illnesses in Belém, North Brazil, for the presence of human herpesvirus-7 (HHV-7) IgM and IgG antibodies. Samples were obtained from January 1996 to December 2002 and were processed by a HHV-7-specific indirect immunofluorescence assay (IFA). HHV-7-specific IgM and/or IgG antibodies were found in 190 (51.4%) of these patients, with similar prevalence rates (IgM+ and IgG+ subgroups taken together) for female and male subjects: 52.5% and 50.3%, respectively. Serological status as defined by IgG was identified in 135 (36.5%) patients. In 55 (14.9%) of the patients HHV-7 IgM antibodies were detected. HHV-7 IgM- and- IgG antibody rates were similar (p > 0.05) when male and female subjects are compared: 14.4% versus 15.3% and 38.1% versus 35.0%, respectively. Statistically significant difference (p = 0.003) was noted when HHV-7-IgM-positive female and male patients aged 5-8 months are compared. Prevalence rates ranging from 4.6% (female, 5-8 months of age) to 93.3% (female, > 10 years of age) and 12.2% (male, 5-8 months) to 80.0% (male, 8-10 years of age) were noted in the IgG- positive subgroups. A subgroup (n = 131) of patients with IgM or IgG HHV-7 antibodies were examined for the presence of DNA using a polymerase chain reaction/nested PCR. Recent/active HHV-7 infection occurred at a rate of 11.0% (6/55) among patients whose samples presented IgM+ specific antibodies. In a subgroup (n = 76) of patients with high HHV-7-IgG antibody levels (titre > 1:160) DNA could not be detected in sera examined by PCR/nested PCR. Of the six recent/active infections, four subjects with less than 1 year and two with 3 and 6 years of age, presented typical exanthem subitum (E.S), as defined by higher fever (> 38.0 ºC) with duration of 24 to 72 hours, followed by a maculopapular skin rash. Our results underscore the need for searching HHV-7 infection in patients with exanthematous diseases, particularly those presenting with typical E.S. HHV-7 appears therefore to emerge as a newly recognized pathogen of exanthem in our region.
Resumo:
A proven case of human infection caused by Angiostrongylus costaricensis is reported for the first time in Venezuela. The patient was a 57-year-old female surgically operated because of signs of peritonitis with a palpable mass at the lower right quadrant of the abdomen. WBC count reported 16,600 cells/mm³, with 46% eosinophils. The tumoral aspect of ileocolic area and peritoneal lymph nodes prompted the resection of a large area of the terminal ileum, cecum, part of the ascending colon and a small part of the jejunum, where a small lesion was found. The pathology showed thickened areas of the intestinal wall with areas of hemorrhage and a perforation of the cecum. Histology showed intense eosinophil infiltration of the whole intestinal wall, granulomas with giant cells and eosinophils. Some of the granuloma surrounded round or oval eggs with content characterized by a large empty area, cells or embryo in the center, and sometimes nematode larvae. A cross section of an adult nematode worm was observed inside a branch of mesenteric artery. The intestinal affected area, the characteristics of the lesions, the presence of eggs in the submucosa with nematode larvae inside, and the observation of a nematode inside a mesenteric artery, makes sufficient criteria for the diagnosis of an infection by Angiostrongylus costaricensis.
Resumo:
American tegumentary leishmaniasis presents as two major clinical forms: localized cutaneous leishmaniasis (LCL) and mucocutaneous leishmaniasis (MCL). The immune response in leishmaniasis is efficiently evaluated by the response to Leishmania antigen through the Montenegro skin test (MST). Both LCL and MCL present positive response to MST, indicating that the patients present cell-mediated immunity against the parasite - Leishmania. In spite of the presence of immunity in MCL, this is not sufficient to stop disease progression and prevent resistance to treatment. In this study we demonstrated interleukin (IL) 2, 4, 5 and interferon (IFN) gamma expression in biopsies of MST of ten patients with American tegumentary leishmaniasis. The obtained results were compared between LCL (n = 5) and MCL (n = 5) patients. The MST of MCL patients displayed a higher expression of IL-2, IL-4 and IL-5, in comparison to LCL. There was no significant difference in IFN-gamma expression between groups. The obtained results suggest the role of IL-4 and IL-5 in the maintenance of the immunopathogenic mechanism of the destructive lesions that characterize MCL.
Resumo:
This work attempts to establish dermatological identification patterns for Brazilian cnidarian species and a probable correlation with envenoming severity. In an observational prospective study, one hundred and twenty-eight patients from the North Coast region of São Paulo State, Brazil were seen between 2002 and 2008. About 80% of these showed only local effects (erythema, edema, and pain) with small, less than 20 cm, oval or round skin marks and impressions from small tentacles. Approximately 20% of the victims had long, more than 20 cm, linear and crossed marks with frequent systemic phenomena, such as malaise, vomiting, dyspnea, and tachycardia. The former is compatible with the common hydromedusa from Southeast and Southern Brazil (Olindias sambaquiensis). The long linear marks with intense pain and systemic phenomena are compatible with envenoming by the box jellyfish Tamoya haplonema and Chiropsalmus quadrumanus and the hydrozoan Portuguese man-of-war (Physalis physalis). There was an association between skin marks and probable accident etiology. This simple observation rule can be indicative of severity, as the Cubozoa Class (box jellyfish) and Portuguese man-of-war cause the most severe accidents. In such cases, medical attention, including intensive care, is important, as the systemic manifestations can be associated with death.
Resumo:
In this study, we report on the safety and skin delayed-type hypersensitivity (DTH), responses of the Leishmania donovani whole cell sonicate antigen delivered in conjunction with alum-BCG (AlBCG), Montanide ISA 720 (MISA) or Monophosphoryl lipid A (MPLA) in groups of vervet monkeys. Following three intradermal injections of the inoculums on days 0, 28 and 42, safety and DTH responses were assessed. Preliminary tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ) levels were also measured and these were compared with DTH. Only those animals immunized with alum-BCG reacted adversely to the inoculum by producing ulcerative erythematous skin indurations. Non-parametric analysis of variance followed by a post-test showed significantly higher DTH responses in the MISA+Ag group compared with other immunized groups (p < 0.001). The MPLA+Ag group indicated significantly lower DTH responses to the sonicate antigen compared with the AlBCG+Ag group. There was a significant correlation between the DTH and cytokine responses (p < 0.0001). Based on this study we conclude that Leishmania donovani sonicate antigen containing MISA 720 is safe and is associated with a strong DTH reaction following immunization.