Mortality in immatures of the floodwater mosquito Ochlerotatus albifasciatus (Diptera: Culicidae) and effects of parasitism by Strelkovimermis spiculatus (Nematoda: Mermithidae) in Buenos Aires Province, Argentina

Life tables were constructed for six cohorts of immature stages of the floodwater mosquito Ochlerotatus albifasciatus (Macquart) in a park in Buenos Aires, highlighting the mortality attributable to the parasitic nematode, Strelkovimermis spiculatus Poinar & Camino. Two cohorts were selected to compare parasite incidence in all mosquito stages when low and high parasitism occurred. Development time of Oc. albifasciatus from first instar to adult was 7.7-10 days in the spring, 6 days in the summer, and 10.9-21.9 days in the fall. Survival was estimated as 0-1.4% in the spring, 2% in the summer and 0.2-4.4% in the fall. The highest "K" value (Killing power) occurred during a fall cohort when prevalence of the parasite was 86.9%, and the lowest in a spring cohort. Parasitism occurred during all seasons, but S. spiculatus persisted to adult only in the summer and fall, when adult mosquitoes developed from parasitized third and fourth instars larvae. The abundance of S. spiculatus differed between old and young larvae only when parasite prevalence was the highest. Although pupae and adults of Oc. albifasciatus were parasitized, no pupal mortality attributable to parasitism was recorded. The proportion of parasitized adults ranged from 14.2% and 5.7% in the two cohorts compared. Pupal wet weight and adult wing lengths did not differ between parasitized and unparasitized individuals.

Recovery of soil physical properties by green manure, liming, gypsum and pasture and spontaneous native species¹

Inadequate usage can degrade natural resources, particularly soils. More attention has been paid to practices aiming at the recovery of degraded soils in the last years, e.g, the use of organic fertilizers, liming and introduction of species adapted to adverse conditions. The purpose of this study was therefore to investigate the recovery of physical properties of a Red Latosol (Oxisol) degraded by the construction of a hydroelectric power station. In the study area, a soil layer about 8m thick had been withdrawn by heavy machines leading not only to soil compaction, but resulting in high-degree degradation. The experiment was arranged in a completely randomized design with nine treatments and four replications. The treatments consisted of: 1- soil mobilization by tilling (to ensure the effect of mechanical mobilization in all treatments) without planting, but growth of spontaneous vegetation; 2- Black velvet bean (Stizolobium aterrimum Piper & Tracy); 3- Pigeonpea (Cajanus cajan (L.) DC); 4- Liming + black velvet bean; 5-Liming + pigeonpea until 1994, when replaced by jack bean (Canavalia ensiformis); 6- Liming + gypsum + black velvet bean; 7- Liming + gypsum + pigeonpea until 1994, when replaced by jack bean; and two controls as reference: 8- Native Cerrado vegetation and 9- bare soil (no tilling and no planting), left under natural conditions and in this situation, without spontaneous vegetation. In treatments 1 through 7, the soil was tilled. Treatments were installed in 1992 and left unmanaged for seven years, until brachiaria (Brachiaria decumbens) was planted in all plots in 1999. Seventeen years after implantation, the properties soil macroporosity, microporosity, total porosity, bulk density and aggregate stability were assessed in the previously described treatments in the soil layers 0.00-0.10; 0.10-0.20 and 0.20-0.40 m, and soil Penetration Resistance and soil moisture in 0.00-0.15 and 0.15-0.30 m. The plants were evaluated for: brachiaria dry matter and spontaneous growth of native tree species in the plots as of 2006. Results were analyzed by variance analysis and Tukey´s test at 5 % for mean comparison. In all treatments, except for the bare soil (no recovery measures), ongoing recovery of the degraded soil physical properties was observed. Macroporosity, soil bulk density and total porosity were good soil quality indicators. The occurrence of spontaneous native species indicated the soil recovery process. The best adapted species was Machaerium acutifolium Vogel, with the largest number of plants and most advanced development; the dry matter production of B. decumbens in recovering soil was similar to normal conditions, evidencing soil recovery.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.