Genetic grouping of avian infectious bronchitis virus isolated in Brazil based on RT-PCR/RFLP analysis of the S1 gene

Twelve Brazilian isolates and one reference vaccine strain of avian infectious bronchitis virus (IBV) were propagated in embryonating chicken eggs. The entire S1 glycoprotein gene of these viruses was analysed by reverse-transcriptase-polymerase chain reaction and restriction fragment length polymorphism (RT-PCR-RFLP), using the restriction enzymes HaeIII, XcmI and BstyI. The RFLP patterns led to the classification of these isolates into five distinct genotypes: A, B, C, D and Massachusetts. Five of twelve isolates were grouped in Massachusetts genotype and the remaining seven viruses were classified into four distinct genotypes: A (2), B (2), C (2) or D (1). Such genotyping classification agreed with previous immunological analysis for most of these viruses, highlighting the occurrence of a relevant variability among the IBV strains that are circulating in Brazilian commercial poultry flocks.

Rapid detection of bovine coronavirus by a semi-nested RT-PCR

Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.

Application of the differential display RT-PCR strategy for the identification of inflammation-related mouse genes

The inflammatory response elicited by various stimuli such as microbial products or cytokines is determined by differences in the pattern of cellular gene expression. We have used the differential display RT-PCR (DDRT-PCR) strategy to identify mRNAs that are differentially expressed in various murine cell types stimulated with pro-inflammatory cytokines, microbial products or anti-inflammatory drugs. Mouse embryonic fibroblasts (MEFs) were treated with IFNs, TNF, or sodium salicylate. Also, peritoneal macrophages from C3H/Hej mice were stimulated with T. cruzi-derived GPI-mucin and/or IFN-g. After DDRT-PCR, various cDNA fragments that were differentially represented on the sequencing gel were recovered, cloned and sequenced. Here, we describe a summary of several experiments and show that, when 16 of a total of 28 recovered fragments were tested for differential expression, 5 (31%) were found to represent mRNAs whose steady-state levels are indeed modulated by the original stimuli. Some of the identified cDNAs encode for known proteins that were not previously associated with the inflammatory process triggered by the original stimuli. Other cDNA fragments (8 of 21 sequences, or 38%) showed no significant homology with known sequences and represent new mouse genes whose characterization might contribute to our understanding of inflammation. In conclusion, DDRT-PCR has proven to be a potent technology that will allow us to identify genes that are differentially expressed when cells are subjected to changes in culture conditions or isolated from different organs.

A simple RT-PCR-based strategy for screening connexin identity

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

Comparison of the quantitative competitive and semiquantitative RT-PCR methods for the determination of interferon-gamma mRNA levels in AIDS-free HIV-infected individuals

IFN-gamma mRNA expression was evaluated in nonstimulated peripheral blood mononuclear cells (PBMC) of HIV-infected and seronegative individuals using quantitative competitive and semiquantitative RT-PCR and the sensitivity of these methods was compared. A significant correlation was found between quantitative competitive and semiquantitative RT-PCR in samples of both HIV-seronegative (P = 0.004) and HIV-infected individuals (P = 0.0004). PBMC from HIV-infected individuals presented a remarkable increase of IFN-gamma mRNA expression, as determined by both types of RT-PCR methods. Semiquantitative RT-PCR even without an internal standard is also acceptable for measuring cytokine mRNA expression, but less reliable if small amounts are quantified. Moreover, we found that increased IFN-gammamRNA expression is independent of CD4+ cell count in AIDS-free HIV-infected patients.

Standard-curve competitive RT-PCR quantification of myogenic regulatory factors in chicken embryos

The reverse transcription-polymerase chain reaction (RT-PCR) is the most sensitive method used to evaluate gene expression. Although many advances have been made since quantitative RT-PCR was first described, few reports deal with the mathematical bases of this technique. The aim of the present study was to develop and standardize a competitive PCR method using standard-curves to quantify transcripts of the myogenic regulatory factors MyoD, Myf-5, Myogenin and MRF4 in chicken embryos. Competitor cDNA molecules were constructed for each gene under study using deletion primers, which were designed to maintain the anchorage sites for the primers used to amplify target cDNAs. Standard-curves were prepared by co-amplification of different amounts of target cDNA with a constant amount of competitor. The content of specific mRNAs in embryo cDNAs was determined after PCR with a known amount of competitor and comparison to standard-curves. Transcripts of the housekeeping ß-actin gene were measured to normalize the results. As predicted by the model, most of the standard-curves showed a slope close to 1, while intercepts varied depending on the relative efficiency of competitor amplification. The sensitivity of the RT-PCR method permitted the detection of as few as 60 MyoD/Myf-5 molecules per reaction but approximately 600 molecules of MRF4/Myogenin mRNAS were necessary to produce a measurable signal. A coefficient of variation of 6 to 19% was estimated for the different genes analyzed (6 to 9 repetitions). The competitive RT-PCR assay described here is sensitive, precise and allows quantification of up to 9 transcripts from a single cDNA sample.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE). METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR) (genes vanA-vanB) for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively) when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

Fast test for assessing the susceptibility of Mycobacterium tuberculosis to isoniazid and rifampin by real-time PCR

Mycobacterium tuberculosis is the bacterium that causes tuberculosis (TB), a leading cause of death from infectious disease worldwide. Rapid diagnosis of resistant strains is important for the control of TB. Real-time polymerase chain reaction (RT-PCR) assays may detect all of the mutations that occur in the M. tuberculosis 81-bp core region of the rpoB gene, which is responsible for resistance to rifampin (RIF) and codon 315 of the katG gene and the inhA ribosomal binding site, which are responsible for isoniazid (INH). The goal of this study was to assess the performance of RT-PCR compared to traditional culture-based methods for determining the drug susceptibility of M. tuberculosis. BACTEC TM MGIT TM 960 was used as the gold standard method for phenotypic drug susceptibility testing. Susceptibilities to INH and RIF were also determined by genotyping of katG, inhA and rpoB genes. RT-PCR based on molecular beacons probes was used to detect specific point mutations associated with resistance. The sensitivities of RT-PCR in detecting INH resistance using katG and inhA targets individually were 55% and 25%, respectively and 73% when combined. The sensitivity of the RT-PCR assay in detecting RIF resistance was 99%. The median time to complete the RT-PCR assay was three-four hours. The specificities for tests were both 100%. Our results confirm that RT-PCR can detect INH and RIF resistance in less than four hours with high sensitivity.

The use of reverse transcription-PCR for the diagnosis of X-linked chronic granulomatous disease

Chronic granulomatous disease (CGD) is an inherited disorder of the innate immune system characterized by a defective oxidative burst of phagocytes and subsequent impairment of their microbicidal activity. Mutations in one of the NADPH-oxidase components affect gene expression or function of this system, leading to the phenotype of CGD. Defects in gp91-phox lead to X-linked CGD, responsible for approximately 70% of CGD cases. Investigation of the highly heterogeneous genotype of CGD patients includes mutation analysis, Northern blot or Western blot assays according to the particular case. The aim of the present study was to use reverse transcription (RT)-PCR for the analysis of molecular defects responsible for X-linked CGD in eight Brazilian patients and to assess its potential for broader application to molecular screening in CGD. Total RNA was prepared from Epstein B virus-transformed B-lymphocytes and reverse transcribed using random hexamers. The resulting cDNA was PCR-amplified by specific and overlapping pairs of primers designed to amplify three regions of the gp91-phox gene: exons 1-5, 3-9, and 7-13. This strategy detected defective gp91-phox expression in seven patients. The RT-PCR results matched clinical history, biochemical data (nitroblue tetrazolium or superoxide release assay) and available mutation analysis in four cases. In three additional cases, RT-PCR results matched clinical history and biochemical data. In another case, RT-PCR was normal despite a clinical history compatible with CGD and defective respiratory burst. We conclude that this new application of RT-PCR analysis - a simple, economical and rapid method - was appropriate for screening molecular defects in 7 of 8 X-linked CGD patients.

Vírus dengue em larvas de Aedes aegypti e sua dinâmica de infestação, Roraima, Brasil

OBJETIVO: Identificar a presença do vírus dengue em formas larvais de Aedes aegypti e relacionar a presença do vetor com índice pluviométrico e número de casos de dengue. MÉTODOS: Dezoito domicílios foram selecionados aleatoriamente para coleta de ovos em um bairro da cidade de Boa Vista (RR). Foram instaladas duas ovitrampas por domicílio e removidas após uma semana, mensalmente, de novembro de 2006 a maio de 2007. Foram calculados o índice de positividade de ovitrampa e o índice de densidade dos ovos. Após eclosão de 1.422 ovos coletados, foram formados 44 pools de no máximo 30 larvas para teste de presença do vírus dengue por meio de RT-PCR e hemi-nested PCR. O índice de incidência de dengue no período foi correlacionado com a precipitação pluvial. A associação entre essas variáveis e número de ovos coletados foi analisada pelo coeficiente de Pearson. RESULTADOS: Nenhum dos pools apresentou positividade para o vírus dengue, apesar do bairro ter apresentado elevados índices de incidência de dengue no período estudado. A densidade da população de Ae. aegypti aumentou conforme a pluviosidade, mas não apresentou correlação com índices de incidência de casos de dengue. CONCLUSÕES: Os resultados sugerem que a transmissão transovariana do vírus em mosquitos ocorre a uma freqüência muito baixa e por isso sua persistência em meio urbano pode não depender desse fenômeno. A população do mosquito aumentou no período de chuvas devido à formação de criadouros; a não-correlação com o índice de incidência de dengue deve-se à possibilidade desse dado ser subestimado em períodos de epidemia.

Co-infecção por HIV/HCV em hospital universitário de Recife, Brasil

OBJETIVO: Estimar a prevalência do vírus da hepatite C (HCV) e fatores de risco associados com a co-infecção em pessoas soropositivas para HIV. MÉTODOS: Estudo do tipo transversal, descritivo e analítico, com 343 portadores do HIV atendidos em um hospital universitário de Recife (PE), no período de março a dezembro de 2003. Os pacientes foram submetidos a um questionário padronizado sobre os fatores de risco. Nas amostras de soro foram pesquisados o anti-HCV pelo ELISA, o HCV-RNA por meio da RT-PCR e a identificação dos genótipos foi realizada no equipamento ABI377 (PE Biosystems®). As análises estatísticas utilizadas foram a univariada, a multivariada e a regressão logística múltipla. RESULTADOS: A prevalência encontrada para o HCV foi de 4,1% (14/343) pelo ELISA e de 3,2 % (11/343) quando utilizada a RT-PCR. Os genótipos mais freqüentes foram 1b (45%), 3 (33%) e 1a (22%). A faixa etária com maior proporção de co-infectados foi a de 30 a 39 anos, com predomínio do sexo masculino (64,3%). Após regressão logística múltipla, apenas a variável transfusão sangüínea permaneceu como fator de risco para o HCV (OR=4,28; IC 95%: 1,44;12,73). CONCLUSÕES: A prevalência da co-infecção HIV/HCV foi baixa, a transfusão sangüínea foi um fator de risco e o genótipo 1b do HCV foi o mais freqüente.

HANTAVIRUS PULMONARY SYNDROME (HPS) IN GUARIBA, SP, BRAZIL: REPORT OF 2 CASES

Human infections caused by a hantavirus were reported in different regions of the State of São Paulo (SP), Brazil during the first six months of 1998. Two cases of fatal pulmonary syndrome occurred in May of 1998 in the City of Guariba, located in the Northeastern Region of SP. Both patients worked in a corn storage barn infested by rodents. These patients, after 2 or 3 days of non-specific febrile illness, developed a severe interstitial pneumonia spreading widely in both lungs, causing respiratory failure and death. At autopsy both patients showed lung interstitial edema with immunoblast-like mononuclear cell infiltrates, consistent with a viral etiology. Hantavirus infection was diagnosed by ELISA in both cases and by RT-PCR in one of the patients. Aspects of the clinical presentation, physiopathology and differential diagnosis of Hantavirus Pulmonary Syndrome are discussed.

Characterization of rotavirus P genotypes circulating among paediatric inpatients in Northern Brazil

Between November 1992 and August 1993, twenty-eight rotavirus-positive stool samples obtained from paediatric inpatients in Belém, Brazil, aged less than four years, were tested by RT-PCR to determine the P genotype specificities. With the exception of 7 non-diarrhoeic children, all patients were either diarrhoeic at admission or developed diarrhoea while in hospital. Rotavirus strains with the gene 4 alleles corresponding to P1B[4] and P1A[8] types (both of which bearing G2 specificity) predominated, accounting for 78.6% of the strains. While only one P2A[6] type strain - with (mixed) G1 and 4 type specificities - was detected, the gene 4 allele could not be identified in 4 (14.3%) of the strains. Most (81%) of the specimens were obtained from children during their first 18 months of life. Rotavirus strains bearing single P1B[4] type-specificity were identified in both diarrhoeic (either nosocomial, 28.6% or community-acquired diarrhoea, 28.6%) and non-diarrhoeic (42.8%) children. P1A[8] gene 4 allele, on the other hand, was detected only among diarrhoeic children, at rates of 57.1% and 42.9% for nosocomial- and- community acquired diarrhoea, respectively. Mixed P1A[8],1B[4] type infection was identified in only one case of community-acquired diarrhoea.

Detection of enteroviruses in cases of neurological disorders in the State of Pará, Brazil

Eighty-one cerebrospinal fluid (CSF) samples mainly from cases of aseptic meningitis and motor deficiency syndrome were sent to the Virology Section of Evandro Chagas Institute, Belém Pará, in the period of January 1995 to January 1996 in order to isolate viruses. All samples were inoculated onto HEp-2 cell culture and newborn mice, with negative results. The probability of isolating viruses by these methods is reduced because of the low concentration of viral particles in these specimens. In order to obtain more information about the etiology of these cases, a group of 23 samples were selected to be tested by a more sensitive technique than the virus isolation - the reverse transcription polymerase chain reaction (RT-PCR). Specific primers directed to conserved regions in the enterovirus genome were used, considering that this group of viruses is frequently associated with these neurological disorder. The age of the patients ranged from 1 to 55 years and nearly all of them lived in Belém, State of Pará, North of Brazil. Of 15 samples analyzed by RT PCR nine (60%) were positive; of these, 6 (66.6%) had motor deficiency and 3 (33.3%) developed aseptic meningitis. These results show that it is important to investigate enterovirus as cause of these syndromes.