The control of deliberate waiting strategies in a stop-signal task

To inhibit an ongoing flow of thoughts or actions has been largely considered to be a crucial executive function, and the stop-signal paradigm makes inhibitory control measurable. Stop-signal tasks usually combine two concurrent tasks, i.e., manual responses to a primary task (go-task) are occasionally countermanded by a stimulus which signals participants to inhibit their response in that trial (stop-task). Participants are always instructed not to wait for the stop-signal, since waiting strategies cause the response times to be unstable, invalidating the data. The aim of the present study was to experimentally control the strategies of waiting deliberately for the stop-signal in a stop-task by means of an algorithm that measured the variation in the reaction times to go-stimuli on-line, and displayed a warning legend urging participants to be faster when their reaction times were more than two standard deviations of the mean. Thirty-four university students performed a stop-task with go- and stop-stimuli, both of which were delivered in the visual modality and were lateralized within the visual field. The participants were divided into two groups (group A, without the algorithm, vs group B, with the algorithm). Group B exhibited lower variability of reaction times to go-stimuli, whereas no significant between-group differences were found in any of the measures of inhibitory control, showing that the algorithm succeeded in controlling the deliberate waiting strategies. Differences between deliberate and unintentional waiting strategies, and anxiety as a probable factor responsible for individual differences in deliberate waiting behavior, are discussed.

Genotoxic, neurotoxic and neuroprotective activities of apomorphine and its oxidized derivative 8-oxo-apomorphine

Apomorphine is a dopamine receptor agonist proposed to be a neuroprotective agent in the treatment of patients with Parkinson's disease. Both in vivo and in vitro studies have shown that apomorphine displays both antioxidant and pro-oxidant actions, and might have either neuroprotective or neurotoxic effects on the central nervous system. Some of the neurotoxic effects of apomorphine are mediated by its oxidation derivatives. In the present review, we discuss recent studies from our laboratory in which the molecular, cellular and neurobehavioral effects of apomorphine and its oxidized derivative, 8-oxo-apomorphine-semiquinone (8-OASQ), were evaluated in different experimental models, i.e., in vitro genotoxicity in Salmonella/microsome assay and WP2 Mutoxitest, sensitivity assay in Saccharomyces cerevisiae, neurobehavioral procedures (inhibition avoidance task, open field behavior, and habituation) in rats, stereotyped behavior in mice, and Comet assay and oxidative stress analyses in mouse brain. Our results show that apomorphine and 8-OASQ induce differential mutagenic, neurochemical and neurobehavioral effects. 8-OASQ displays cytotoxic effects and oxidative and frameshift mutagenic activities, while apomorphine shows antimutagenic and antioxidant effects in vitro. 8-OASQ induces a significant increase of DNA damage in mouse brain tissue. Both apomorphine and 8-OASQ impair memory for aversive training in rats, although the two drugs showed a different dose-response pattern. 8-OASQ fails to induce stereotyped behaviors in mice. The implications of these findings are discussed in the light of evidence from studies by other groups. We propose that the neuroprotective and neurotoxic effects of dopamine agonists might be mediated, in part, by their oxidized metabolites.

Adenosine A1 receptor-mediated inhibition of in vitro prolactin secretion from the rat anterior pituitary

In previous studies, we demonstrated biphasic purinergic effects on prolactin (PRL) secretion stimulated by an adenosine A2 agonist. In the present study, we investigated the role of the activation of adenosine A1 receptors by (R)-N6-(2-phenylisopropyl)adenosine (R-PIA) at the pituitary level in in vitro PRL secretion. Hemipituitaries (one per cuvette in five replicates) from adult male rats were incubated. Administration of R-PIA (0.001, 0.01, 0.1, 1, and 10 µM) induced a reduction of PRL secretion into the medium in a U-shaped dose-response curve. The maximal reduction was obtained with 0.1 µM R-PIA (mean ± SEM, 36.01 ± 5.53 ng/mg tissue weight (t.w.)) treatment compared to control (264.56 ± 15.46 ng/mg t.w.). R-PIA inhibition (0.01 µM = 141.97 ± 15.79 vs control = 244.77 ± 13.79 ng/mg t.w.) of PRL release was blocked by 1 µM cyclopentyltheophylline, a specific A1 receptor antagonist (1 µM = 212.360 ± 26.560 ng/mg t.w.), whereas cyclopentyltheophylline alone (0.01, 0.1, 1 µM) had no effect. R-PIA (0.001, 0.01, 0.1, 1 µM) produced inhibition of PRL secretion stimulated by both phospholipase C (0.5 IU/mL; 977.44 ± 76.17 ng/mg t.w.) and dibutyryl cAMP (1 mM; 415.93 ± 37.66 ng/mg t.w.) with nadir established at the dose of 0.1 µM (225.55 ± 71.42 and 201.9 ± 19.08 ng/mg t.w., respectively). Similarly, R-PIA (0.01 µM) decreased (242.00 ± 24.00 ng/mg t.w.) the PRL secretion stimulated by cholera toxin (0.5 mg/mL; 1050.00 ± 70.00 ng/mg t.w.). In contrast, R-PIA had no effect (468.00 ± 34.00 ng/mg t.w.) on PRL secretion stimulation by pertussis toxin (0.5 mg/mL; 430.00 ± 26.00 ng/mg t.w.). These results suggest that inhibition of PRL secretion after A1 receptor activation by R-PIA is mediated by a Gi protein-dependent mechanism.

Consequences of cerebroventricular insulin injection on renal sodium handling in rats: effect of inhibition of central nitric oxide synthase

In the present study, we investigated the effects of acute intracerebroventricular (icv) insulin administration on central mechanisms regulating urinary sodium excretion in simultaneously centrally NG-nitro-L-arginine methylester (L-NAME)-injected unanesthetized rats. Male Wistar-Hannover rats were randomly assigned to one of five groups: a) icv 0.15 M NaCl-injected rats (control, N = 10), b) icv dose-response (1.26, 12.6 and 126 ng/3 µL) insulin-injected rats (N = 10), c) rats icv injected with 60 µg L-NAME in combination with NaCl (N = 10) or d) with insulin (N = 10), and e) subcutaneously insulin-injected rats (N = 5). Centrally administered insulin produced an increase in urinary output of sodium (NaCl: 855.6 ± 85.1 Δ%/min; 126 ng insulin: 2055 ± 310.6 Δ%/min; P = 0.005) and potassium (NaCl: 460.4 ± 100 Δ%/min; 126 ng insulin: 669.2 ± 60.8 Δ%/min; P = 0.025). The urinary sodium excretion response to icv 126 ng insulin microinjection was significantly attenuated by combined administration of L-NAME (126 ng insulin: 1935 ± 258.3 Δ%/min; L-NAME + 126 ng insulin: 582.3 ± 69.6 Δ%/min; P = 0.01). Insulin-induced natriuresis occurred by increasing post-proximal sodium excretion, despite an unchanged glomerular filtration rate. Although the rationale for decreased urinary sodium excretion induced by combined icv L-NAME and insulin administration is unknown, it is tempting to suggest that perhaps one of the efferent signals triggered by insulin in the CNS may be nitrergic in nature.

Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Neural regulation of the stress response: glucocorticoid feedback mechanisms

The mammalian stress response is an integrated physiological and psychological reaction to real or perceived adversity. Glucocorticoids are an important component of this response, acting to redistribute energy resources to both optimize survival in the face of challenge and to restore homeostasis after the immediate challenge has subsided. Release of glucocorticoids is mediated by the hypothalamo-pituitary-adrenal (HPA) axis, driven by a neural signal originating in the paraventricular nucleus (PVN). Stress levels of glucocorticoids bind to glucocorticoid receptors in multiple body compartments, including the brain, and consequently have wide-reaching actions. For this reason, glucocorticoids serve a vital function in negative feedback inhibition of their own secretion. Negative feedback inhibition is mediated by a diverse collection of mechanisms, including fast, non-genomic feedback at the level of the PVN, stress-shut-off at the level of the limbic system, and attenuation of ascending excitatory input through destabilization of mRNAs encoding neuropeptide drivers of the HPA axis. In addition, there is evidence that glucocorticoids participate in stress activation via feed-forward mechanisms at the level of the amygdala. Feedback deficits are associated with numerous disease states, underscoring the necessity for adequate control of glucocorticoid homeostasis. Thus, rather than having a single, defined feedback ‘switch’, control of the stress response requires a wide-reaching feedback ‘network’ that coordinates HPA activity to suit the overall needs of multiple body systems.

Facilitatory effects of an auditory warning stimulus in a visual location identification task and a visual shape identification task

The occurrence of a weak auditory warning stimulus increases the speed of the response to a subsequent visual target stimulus that must be identified. This facilitatory effect has been attributed to the temporal expectancy automatically induced by the warning stimulus. It has not been determined whether this results from a modulation of the stimulus identification process, the response selection process or both. The present study examined these possibilities. A group of 12 young adults performed a reaction time location identification task and another group of 12 young adults performed a reaction time shape identification task. A visual target stimulus was presented 1850 to 2350 ms plus a fixed interval (50, 100, 200, 400, 800, or 1600 ms, depending on the block) after the appearance of a fixation point, on its left or right side, above or below a virtual horizontal line passing through it. In half of the trials, a weak auditory warning stimulus (S1) appeared 50, 100, 200, 400, 800, or 1600 ms (according to the block) before the target stimulus (S2). Twelve trials were run for each condition. The S1 produced a facilitatory effect for the 200, 400, 800, and 1600 ms stimulus onset asynchronies (SOA) in the case of the side stimulus-response (S-R) corresponding condition, and for the 100 and 400 ms SOA in the case of the side S-R non-corresponding condition. Since these two conditions differ mainly by their response selection requirements, it is reasonable to conclude that automatic temporal expectancy influences the response selection process.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

PPARγ induces growth inhibition and apoptosis through upregulation of insulin-like growth factor-binding protein-3 in gastric cancer cells

Peroxisome proliferator activator receptor-gamma (PPARγ) is a ligand-activated transcriptional factor involved in the carcinogenesis of various cancers. Insulin-like growth factor-binding protein-3 (IGFBP-3) is a tumor suppressor gene that has anti-apoptotic activity. The purpose of this study was to investigate the anticancer mechanism of PPARγ with respect to IGFBP-3. PPARγ was overexpressed in SNU-668 gastric cancer cells using an adenovirus gene transfer system. The cells in which PPARγ was overexpressed exhibited growth inhibition, induction of apoptosis, and a significant increase in IGFBP-3 expression. We investigated the underlying molecular mechanisms of PPARγ in SNU-668 cells using an IGFBP-3 promoter/luciferase reporter system. Luciferase activity was increased up to 15-fold in PPARγ transfected cells, suggesting that PPARγ may directly interact with IGFBP-3 promoter to induce its expression. Deletion analysis of the IGFBP-3 promoter showed that luciferase activity was markedly reduced in cells without putative p53-binding sites (-Δ1755, -Δ1795). This suggests that the critical PPARγ-response region is located within the p53-binding region of the IGFBP-3 promoter. We further demonstrated an increase in PPARγ-induced luciferase activity even in cells treated with siRNA to silence p53 expression. Taken together, these data suggest that PPARγ exhibits its anticancer effect by increasing IGFBP-3 expression, and that IGFBP-3 is a significant tumor suppressor.