Detecção de allexivírus em primórdios foliares de alho via RT-PCR

Nos procedimentos de detecção de allexivirus em bulbos de alho, tem-se como rotina o plantio de bulbilhos para obtenção de tecido foliar a ser analisado via testes sorológicos e/ou moleculares. A disponibilização das plantas em casa de vegetação implica em gastos com a manutenção e requer, em média, 30 dias. Em áreas isentas desses vírus, corre-se, ainda, o risco de sua introdução e disseminação. No presente trabalho buscou-se ajustar um protocolo para detecção rápida de allexivírus em alho a partir de primórdios foliares. Bulbilhos de alho para consumo, oriundos do Rio Grande do Sul e importados da Argentina foram dissecados para obtenção de primórdios foliares e extração de RNA total a partir de 0,1 g de tecido. A seguir foram conduzidas reações de RT-PCR com um par de oligonucleotídeos, capaz de gerar um fragmento de aproximadamente 500 pb relativo à porção interna do gene da capa protéica de várias espécies do gênero Allexivirus. Uma banda com tamanho aproximado de 500 pb foi visualizada, em gel de agarose e, posteriormente, confirmada por Southern Blot e por seqüenciamento como sendo Garlic vírus C (GarV-C, AY170322.1). A obtenção de RNA total diretamente de primórdios foliares de bulbilhos e seu uso em análise de RT-PCR, constituem-se em uma metodologia econômica, rápida e segura para a detecção de allexivírus em bulbos de alho.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

O Bidens mosaic virus (BiMV) é uma espécie tentativa do gênero Potyvirus, que infecta alface (Lactuca sativa). Na ausência de métodos eficientes para diagnose deste vírus, o objetivo do trabalho foi a síntese de oligonucleotídeos específicos e sua otimização em testes de RT-PCR em uma só etapa, partindo-se de extrações de RNA total. Os oligonucleotídeos 8851sens (5'AGG CAG TTC GCA CGG CAT AC 3´) e 9211ant (5´ CTT CAT CTG GAT GTG TGC TTC 3´) permitem a eficiente detecção do vírus e possibilitaram a descoberta de uma nova hospedeira do vírus, a planta Galinsoga parviflora, comumente encontrada em canteiros de produção comercial de alface.

Genetic grouping of avian infectious bronchitis virus isolated in Brazil based on RT-PCR/RFLP analysis of the S1 gene

Twelve Brazilian isolates and one reference vaccine strain of avian infectious bronchitis virus (IBV) were propagated in embryonating chicken eggs. The entire S1 glycoprotein gene of these viruses was analysed by reverse-transcriptase-polymerase chain reaction and restriction fragment length polymorphism (RT-PCR-RFLP), using the restriction enzymes HaeIII, XcmI and BstyI. The RFLP patterns led to the classification of these isolates into five distinct genotypes: A, B, C, D and Massachusetts. Five of twelve isolates were grouped in Massachusetts genotype and the remaining seven viruses were classified into four distinct genotypes: A (2), B (2), C (2) or D (1). Such genotyping classification agreed with previous immunological analysis for most of these viruses, highlighting the occurrence of a relevant variability among the IBV strains that are circulating in Brazilian commercial poultry flocks.

Rapid detection of bovine coronavirus by a semi-nested RT-PCR

Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.

Application of the differential display RT-PCR strategy for the identification of inflammation-related mouse genes

The inflammatory response elicited by various stimuli such as microbial products or cytokines is determined by differences in the pattern of cellular gene expression. We have used the differential display RT-PCR (DDRT-PCR) strategy to identify mRNAs that are differentially expressed in various murine cell types stimulated with pro-inflammatory cytokines, microbial products or anti-inflammatory drugs. Mouse embryonic fibroblasts (MEFs) were treated with IFNs, TNF, or sodium salicylate. Also, peritoneal macrophages from C3H/Hej mice were stimulated with T. cruzi-derived GPI-mucin and/or IFN-g. After DDRT-PCR, various cDNA fragments that were differentially represented on the sequencing gel were recovered, cloned and sequenced. Here, we describe a summary of several experiments and show that, when 16 of a total of 28 recovered fragments were tested for differential expression, 5 (31%) were found to represent mRNAs whose steady-state levels are indeed modulated by the original stimuli. Some of the identified cDNAs encode for known proteins that were not previously associated with the inflammatory process triggered by the original stimuli. Other cDNA fragments (8 of 21 sequences, or 38%) showed no significant homology with known sequences and represent new mouse genes whose characterization might contribute to our understanding of inflammation. In conclusion, DDRT-PCR has proven to be a potent technology that will allow us to identify genes that are differentially expressed when cells are subjected to changes in culture conditions or isolated from different organs.

A simple RT-PCR-based strategy for screening connexin identity

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

The performance of semi-quantitative differential PCR is similar to that of real-time PCR for the detection of the MYCN gene in neuroblastomas

Amplification of the MYCN gene in neuroblastomas is a potent biological marker of highly aggressive tumors, which are invariably fatal unless sound clinical management is applied. To determine the usefulness of semi-quantitative differential PCR (SQ-PCR) for accurate quantification of MYCN gene copy number, we evaluated the analytical performance of this method by comparing the results obtained with it for 101 tumor samples of neuroblastoma to that obtained by absolute and relative real-time PCR. Similar results were obtained for 100 (99%) samples, no significant difference was detected between the median log10 MYCN copy number (1.53 by SQ-PCR versus 1.55 by absolute real-time PCR), and the results of the two assays correlated closely (r = 0.8, Pearson correlation; P < 0.001). In the comparison of SQ-PCR and relative real-time PCR, SQ-PCR versus relative real-time PCR concordant results were found in 100 (99%) samples, no significant difference was found in median log10 MYCN copy number (1.53 by SQ-PCR versus 1.27 by relative real-time PCR), and the results of the two assays correlated closely (r = 0.8, Pearson correlation; P < 0.001). These findings indicate that the performance of SQ-PCR was comparable to that of real-time PCR for the amplification and quantification of MYCN copy number. Thus, SQ-PCR can be reliably used as an alternative assay in laboratories without facilities for real-time PCR.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Failure to demonstrate experimental vertical transmission of the epidemic strain of Chikungunya virus in Aedes albopictus from La Réunion Island, Indian Ocean

Aedes albopictus was responsible for transmission in the first outbreak of chikungunya (CHIK) on La Réunion Island, Indian Ocean, in 2005-2006. The magnitude of the outbreak on this island, which had been free of arboviral diseases for over 30 years, as well as the efficiency of Ae. albopictus as the main vector, raises questions about the maintenance of the CHIK virus (CHIKV) through vertical transmission mechanisms. Few specimens collected from the field as larvae were found to be infected. In this study, Ae. albopictus originating from La Réunion were orally infected with a blood-meal containing 10(8) pfu/mL of the CHIKV epidemic strain (CHIKV 06.21). Eggs from the first and second gonotrophic cycles were collected and raised to the adult stage. The infectious status of the progeny was checked (i) by immunofluorescence on head squashes of individual mosquitoes to detect the presence of viral particles or (ii) by quantitative RT-PCR on mosquito pools to detect viral RNA. We analysed a total of 1,675 specimens from the first gonotrophic cycle and 1,709 from the second gonotrophic cycle without detecting any viral particles or viral RNA. These laboratory results are compared to field records.

Gene expression profile during coffee fruit development and identification of candidate markers for phenological stages

The objective of this work was to identify genes that could be used as suitable markers for molecular recognition of phenological stages during coffee (Coffea arabica) fruit development. Four cultivars were evaluated as to their differential expression of genes associated to fruit development and maturation processes. Gene expression was characterized by both semi-quantitative and quantitative RT-PCR, in fruit harvested at seven different developmental stages, during three different seasons. No size polymorphisms or differential expression were observed among the cultivars for the evaluated genes; however, distinct expression profiles along fruit development were determined for each gene. Four out of the 28 evaluated genes exhibited a regular expression profile in all cultivars and harvest seasons, and, therefore, they were validated as candidate phenological markers of coffee fruit. The gene α-galactosidase can be used as a marker of green stage, caffeine synthase as a marker of transition to green and yellowish-green stages, and isocitrate lyase and ethylene receptor 3 as markers of late maturation.

TIMP-1 mediates the inhibitory effect of interleukin-6 on the proliferation of a hepatocarcinoma cell line in a STAT3-dependent manner

The tissue inhibitor of metalloproteinases (TIMP)-1 is a multifunctional protein which is not only an inhibitor of matrix metalloproteinases (MMPs) but also to have a possible "cytokine-like" action. Here, we first compared mRNA expression of TIMP-1 and MMP-9 in BEL-7402 (a hepatocellular carcinoma cell line), L-02 (a normal liver cell line) and QSG-7701 (a cell line derived from peripheral tissue of liver carcinoma) using real-time quantitative RT-PCR. By evaluating the variation of the MMP-9/TIMP-1 ratio as an index of reciprocal changes of the expression of the two genes, we observed that the MMP-9/TIMP-1 ratio was about 13- and 5-fold higher in BEL-7402 than in L-02 and QSG-7701, respectively. Significantly, overexpression of TIMP-1 decreased the MMP-9/TIMP-1 ratio in BEL-7402 and then inhibited the cell growth to 60% and reduced the migration to about 30%. Meanwhile, our data showed that interleukin-6 (IL-6) (100 ng/mL) could also inhibited the cell growth of BEL-7402. Further studies indicated that TIMP-1 mediated the inhibitory effect of IL-6 on BEL-7402 cell proliferation in a STAT3-dependent manner, which could further accelerate the expression of the cyclin-dependent kinase inhibitor p21. A dominant negative STAT3 mutant totally abolished IL-6-induced TIMP-1 expression and its biological functions. The present results demonstrate that TIMP-1 may be one of the mediators that regulate the inhibitory effect of IL-6 on BEL-7402 proliferation in which STAT3 signal transduction and p21 up-regulation also play important roles.

Down-regulation of the cardiac sarcoplasmic reticulum ryanodine channel in severely food-restricted rats

We have shown that myocardial dysfunction induced by food restriction is related to calcium handling. Although cardiac function is depressed in food-restricted animals, there is limited information about the molecular mechanisms that lead to this abnormality. The present study evaluated the effects of food restriction on calcium cycling, focusing on sarcoplasmic Ca2+-ATPase (SERCA2), phospholamban (PLB), and ryanodine channel (RYR2) mRNA expressions in rat myocardium. Male Wistar-Kyoto rats, 60 days old, were submitted to ad libitum feeding (control rats) or 50% diet restriction for 90 days. The levels of left ventricle SERCA2, PLB, and RYR2 were measured using semi-quantitative RT-PCR. Body and ventricular weights were reduced in 50% food-restricted animals. RYR2 mRNA was significantly decreased in the left ventricle of the food-restricted group (control = 5.92 ± 0.48 vs food-restricted group = 4.84 ± 0.33, P < 0.01). The levels of SERCA2 and PLB mRNA were similar between groups (control = 8.38 ± 0.44 vs food-restricted group = 7.96 ± 0.45, and control = 1.52 ± 0.06 vs food-restricted group = 1.53 ± 0.10, respectively). Down-regulation of RYR2 mRNA expressions suggests that chronic food restriction promotes abnormalities in sarcoplasmic reticulum Ca2+ release.

Psychological stress alters the ultrastructure and increases IL-1β and TNF-α in mandibular condylar cartilage

Psychological factors can be correlated with temporomandibular disorders (TMDs), but the mechanisms are unknown. In the present study, we examined the microstructural changes and expression of proinflammatory cytokines in mandibular condylar cartilage of the temporomandibular joint (TMJ) in a psychological stress animal model. Male Sprague-Dawley rats (8 weeks old, 210 ± 10 g) were randomly divided into 3 groups: psychological stress (PS, N = 48), foot shock (FS, N = 24), and control (N = 48). After inducing psychological stress using a communication box with the FS rats for 1, 3, or 5 weeks, PS rats were sacrificed and compared to their matched control littermates, which received no stress and were killed at the same times as the PS rats. Body and adrenal gland weight were measured and corticosterone and adrenocorticotropic hormone levels were determined by radioimmunoassay. After hematoxylin-eosin staining for histological observation, the ultrastructure of the TMJ was examined by scanning electron microscopy. Transcription and protein levels of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) were evaluated by ELISA and semi-quantitative RT-PCR. The PS group showed a significantly higher adrenal gland weight after 3 weeks of stress and higher hormone levels at weeks 1, 3, and 5. Histopathological changes and thinning cartilage were apparent at weeks 3 and 5. In the PS group, TNF-α increased at 1, 3, and 5 weeks and IL-1β increased significantly after 1 and 3 weeks of stress, and then decreased to normal levels by 5 weeks. Psychological stress increased plasma hormone levels and RT-PCR indicated increased IL-1β and TNF-α expression in the TMJ in a time-dependent manner. These results suggest that cytokine up-regulation was accompanied by stress-induced cartilage degeneration in the mandibular condyle. The proinflammatory cytokines play a potential role in initiating the cartilage destruction that eventually leads to the TMDs.

Induced maturation of hepatic progenitor cellsin vitro

Hepatic progenitor cells (HPCs) are a potential cell source for liver cell transplantation but do not function like mature liver cells. We sought an effective and reliable method to induce HPC maturation. An immortalized HP14.5 albumin promoter-driven Gaussian luciferase (ALB-GLuc) cell line was established from HPCs isolated from fetal mouse liver of post coitus day 14.5 mice to investigate the effect of induction factors on ALB promoter. HP14.5 parental cells were cultured in DMEM with different combinations of 2% horse serum (HS), 0.1 µM dexamethasone (DEX), 10 ng/mL hepatic growth factor (HGF), and/or 20 ng/mL fibroblast growth factor 4 (FGF4). Trypan blue and crystal violet staining were used to assess cell proliferation with different induction conditions. Expression of hepatic markers was measured by semi-quantitative RT-PCR, Western blot, and immunofluorescence. Glycogen storage and metabolism were detected by periodic acid-Schiff and indocyanine green (ICG) staining. GLuc activity indicated ALB expression. The combination of 2% HS+0.1 µM Dex+10 ng/mL HGF+20 ng/mL FGF4 induced the highest ALB-GLuc activity. Cell proliferation decreased in 2% HS but increased by adding FGF4. Upon induction, and consistent with hepatocyte development, DLK, AFP, and CK19 expression decreased, while ALB, CK18, and UGT1A expression increased. The maturity markers tyrosine aminotransferase and apolipoprotein B were detected at days 3 and 6 post-induction, respectively. ICG uptake and glycogen synthesis were detectable at day 6 and increased over time. Therefore, we demonstrated that HPCs were induced to differentiate into functional mature hepatocytes in vitro, suggesting that factor-treated HPCs may be further explored as a means of liver cell transplantation.

Ropinirole alters gene expression profiles in SH-SY5Y cells: a whole genome microarray study

Ropinirole (ROP) is a dopamine agonist that has been used as therapy for Parkinson's disease. In the present study, we aimed to detect whether gene expression was modulated by ROP in SH-SY5Y cells. SH-SY5Y cell lines were treated with 10 µM ROP for 2 h, after which total RNA was extracted for whole genome analysis. Gene expression profiling revealed that 113 genes were differentially expressed after ROP treatment compared with control cells. Further pathway analysis revealed modulation of the phosphatidylinositol 3-kinase (PI3K) signaling pathway, with prominent upregulation of PIK3C2B. Moreover, batches of regulated genes, including PIK3C2B, were found to be located on chromosome 1. These findings were validated by quantitative RT-PCR and Western blot analysis. Our study, therefore, revealed that ROP altered gene expression in SH-SY5Y cells, and future investigation of PIK3C2B and other loci on chromosome 1 may provide long-term implications for identifying novel target genes of Parkinson's disease.