Molecular analysis of the bacterial diversity in a specialized consortium for diesel oil degradation

Diesel oil is a compound derived from petroleum, consisting primarily of hydrocarbons. Poor conditions in transportation and storage of this product can contribute significantly to accidental spills causing serious ecological problems in soil and water and affecting the diversity of the microbial environment. The cloning and sequencing of the 16S rRNA gene is one of the molecular techniques that allows estimation and comparison of the microbial diversity in different environmental samples. The aim of this work was to estimate the diversity of microorganisms from the Bacteria domain in a consortium specialized in diesel oil degradation through partial sequencing of the 16S rRNA gene. After the extraction of DNA metagenomics, the material was amplified by PCR reaction using specific oligonucleotide primers for the 16S rRNA gene. The PCR products were cloned into a pGEM-T-Easy vector (Promega), and Escherichia coli was used as the host cell for recombinant DNAs. The partial clone sequencing was obtained using universal oligonucleotide primers from the vector. The genetic library obtained generated 431 clones. All the sequenced clones presented similarity to phylum Proteobacteria, with Gammaproteobacteria the most present group (49.8 % of the clones), followed by Alphaproteobacteira (44.8 %) and Betaproteobacteria (5.4 %). The Pseudomonas genus was the most abundant in the metagenomic library, followed by the Parvibaculum and the Sphingobium genus, respectively. After partial sequencing of the 16S rRNA, the diversity of the bacterial consortium was estimated using DOTUR software. When comparing these sequences to the database from the National Center for Biotechnology Information (NCBI), a strong correlation was found between the data generated by the software used and the data deposited in NCBI.

Diallel analysis for grain yield and mineral absorption rate of soybeans grown in acid brazilian savannah soil

High available aluminium and low levels of calcium below the ploughed zone of the soil are limiting factors for agricultural sustainability in the Brazilian Cerrados (Savannahs). The mineral stresses compound with dry spells effect by preventing deep root growth of cultivated plants and causes yield instability. The mode of inheritance for grain yield and mineral absorption ratio of a diallel cross in soybeans [Glycine max (L.) Merrill] grown in high and low Al areas was identified. Differences among the genotypes for grain yield were more evident in the high Al, by grouping tolerant and non-tolerant genotypes for their respective arrays in the hybrids. A large proportion of genetic variance was additive for grain yield and mineral absorption ratio in both environments. High heritability values suggest that soybeans can be improved by crosses among Al-tolerant genotypes, using modified pedigree, early generation and recurrent selection schemes.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Polymorphism of the grasshopper Rhammatocerus schistocercoides populations revealed by RAPD

The objective of this work was to study the genetic variability of the grasshopper Rhammatocerus schistocercoides (Orthoptera: Acrididae) using RAPD analysis among individuals from three populations, one from Colombia and two from Brazil (Goiás and Mato Grosso States). Ninety scorable binary markers were obtained by fingerprinting with 11 oligonucleotide primers. Most of the polymorphism was attributed to 42 markers with variable frequency among the different populations. Although the existence of significant difference among populations (P<0.0001), most of the genetic variability was found within populations (87.7% of total variation). Pairwise distances between Colombian and Brazilian populations were 0.12 (P<0.0001) and 0.18 (P<0.0001) for Goiás and Mato Grosso, respectively. The pairwise distance between Goiás and Mato Grosso populations was 0.06 (P<0.0001). These data indicated that the phenotypic differences among populations are associated mainly with the geographical distances between the Brazilian and Colombian populations.

Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins

In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp.) skin, Desmodium ovalifolium, red grape (Vitis vinifera) skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (P<0.01) when the controls were compared to either buffer treatments due to tannin type, buffer used and the interaction of tannin type and buffer. The significant interaction indicates the influence of tannin type on the parameters evaluated.

Genetic characterization of the Moxotó goat breed using RAPD markers

The objective of this study was to verify the genetic diversity between and within seven populations of Moxotó goat (n = 264) from the States of Pernambuco, Paraíba and Rio Grande do Norte, using RAPD (Random Amplified Polymorphic DNA). Moxotó, as well as other naturalized breeds, suffers genetic losses due to the indiscriminate miscegenation with breeds raised in the Northeast Region of Brazil. The genetic characterization of these genetic resources is essential to conservation and breeding programs. DNA was extracted from lymphocytes using a non-organic protocol. The 16 primers used were selected from 120 decamer oligonucleotide primers and generated 56 polymorphic bands. The analysis of molecular variance (AMOVA) showed that the greater part of total genetic variability (71.55%) was due to differences between individuals within populations, while 21.21% was among populations. The analysis of variance among the pairs of populations demonstrated that the populations located in Floresta, PE x Angicos, RN presented a smaller value of intrapopulational differentiation (8.9%), indicating low genetic variability among them. Nei's genetic distances varied between 0.0546 and 0.1868 in the populations. The dendrogram generated showed that the Canindé breed, used as outgroup, clustered with the populations of Moxotó, indicating a possible common origin of the naturalized goat breeds.

Mating system parameters in a high density population of andirobas in the Amazon forest

The objective of this work was to estimate the mating system parameters of a andiroba (Carapa guianensis) population using microsatellite markers and the mixed and correlated mating models. Twelve open‑pollinated progeny arrays of 15 individuals were sampled in an area with C. guianensis estimated density of 25.7 trees per hectare. Overall, the species has a mixed reproductive system, with a predominance of outcrossing. The multilocus outcrossing rate (t m = 0.862) was significantly lower than the unity, indicating that self‑pollination occurred. The rate of biparental inbreeding was substantial (t m ‑ t s = 0.134) and significantly different from zero. The correlation of selfing within progenies was high (r s = 0.635), indicating variation in the individual outcrossing rate. Consistent with this result, the estimate of the individual outcrossing rate ranged from 0.598 to 0.978. The multilocus correlation of paternity was low (r p(m) = 0.081), but significantly different from zero, suggesting that the progenies contain full‑sibs. The coancestry within progenies (Θ = 0.185) was higher and the variance effective size (Ne(v) = 2.7) was lower than expected for true half‑sib progenies (Θ = 0.125; Ne(v) = 4). These results suggest that, in order to maintain a minimum effective size of 150 individuals for breeding, genetic conservation, and environmental reforestation programs, seeds from at least 56 trees must be collected.

Identification and characterization of a resistance gene analog (RGA) from the Caricaceae Dumort family

The majority of cloned resistance (R) genes characterized so far contain a nucleotide-binding site (NBS) and a leucine-rich repeat (LRR) domain, where highly conserved motifs are found. Resistance genes analogs (RGAs) are genetic markers obtained by a PCR-based strategy using degenerated oligonucleotide primers drawn from these highly conserved "motifs". This strategy has the advantage of the high degree of structural and amino acid sequence conservation that is observed in R genes. The objective of the present study was to search for RGAs in Carica papaya L. and Vasconcellea cauliflora Jacq. A. DC. Out of three combinations of primers tested, only one resulted in amplification. The amplified product was cloned in pCR2.1TOPO and than sequenced using M13 forward and reverse primers. Forty-eight clones were sequenced from each species. The 96 sequences generated for each species were cleaned of vector sequences and clustered using CAP3 assembler. From the GENEBANK, one RGA was identified in C. papaya showing a BlastX e-value of 2x10-61 to the gb|AAP45165.1| putative disease resistant protein RGA3 (Solanum bulbocastanum). To the extent of our knowledge this is the first report of a RGA in the Caricaceae Dumort family. Preliminary structural studies were performed to further characterize this putative NBS-LRR type protein. Efforts to search for other RGAs in papaya should continue, mostly to provide basis for the development of transgenic papaya with resistance to diseases.

Whole-body MRI: comprehensive evaluation on a 48-channel 3T MRI system in less than 40 minutes. Preliminary results

OBJECTIVE: To evaluate a comprehensive MRI protocol that investigates for cancer, vascular disease, and degenerative/inflammatory disease from the head to the pelvis in less than 40 minutes on a new generation 48-channel 3T system. MATERIALS AND METHODS: All MR studies were performed on a 48-channel 3T MR scanner. A 20-channel head/neck coil, two 18-channel body arrays, and a 32-channel spine array were employed. A total of 4 healthy individuals were studied. The designed protocol included a combination of single-shot T2-weighted sequences, T1-weighted 3D gradient-echo pre- and post-gadolinium. All images were retrospectively evaluated by two radiologists independently for overall image quality. RESULTS: The image quality for cancer was rated as excellent in the liver, pancreas, kidneys, lungs, pelvic organs, and brain, and rated as fair in the colon and breast. For vascular diseases ratings were excellent in the aorta, major branch vessel origins, inferior vena cava, portal and hepatic veins, rated as good in pulmonary arteries, and as poor in the coronary arteries. For degenerative/inflammatory diseases ratings were excellent in the brain, liver and pancreas. The inter-observer agreement was excellent. CONCLUSION: A comprehensive and time efficient screening for important categories of disease processes may be achieved with high quality imaging in a new generation 48-channel 3T system.

Espectrofotometria multicanal e arranjos de fotodiodos

This paper describes some aspects of multichannel spectrophotometry, principles of photodiode arrays and their applications in Analytical Chemistry.

Eletrodos fabricados por "silk-screen"

A review dealing with the use of screen-printing technology to manufacture disposable electrodes is presented, covering in details virtually all the publications in the area up to early 1997 and including 206 references. The elements and different strategies on constructing modified electrodes are highlighted. Commercial and Home-made ink recipes are discussed. Microelectrode arrays, built by the combination of photostructuring and screen-printing technologies to the mass production of advanced disposable sensors, are also discussed. Future research trends are predicted.

Extração, estruturas e propriedades de alfa- e beta-quitina

The fact that alpha- and beta-chitin adopt different arrays in the solid state is explored to emphasize their different properties and distinct spectral characteristics and X ray diffraction patterns. The methods for their extraction from the biomass in view of the preservation of their native structures and aiming to fulfill the claims of purity and uniformity for potential applications are discussed. The different arrays adopted by alpha- and beta-chitin also result in distinct reactivities toward the deacetylation reaction. Thus, the deacetylation of beta-chitin is more efficient owing to the better accessibility to amide groups due to the lower crystallinity of this polymorph.

Seeing smells: development of an optoelectronic nose

The development of an array of chemically-responsive dyes on a porous membrane and in its use as a general sensor for odors and volatile organic compounds (VOCs) is reviewed. These colorimetric sensor arrays (CSA) act as an "optoelectronic nose" by using an array of multiple dyes whose color changes are based on the full range of intermolecular interactions. The CSA is digitally imaged before and after exposure and the resulting difference map provides a digital fingerprint for any VOC or mixture of odorants. The result is an enormous increase in discriminatory power among odorants compared to prior electronic nose technologies. For the detection of biologically important analytes, including amines, carboxylic acids, and thiols, high sensitivities (ppbv) have been demonstrated. The array is essentially non-responsive to changes in humidity due to the hydrophobicity of the dyes and membrane.

Resolução multivariada de curvas com mínimos quadrados alternantes: descrição, funcionamento e aplicações

Multivariate Curve Resolution with Alternating Least Squares (MCR-ALS) is a resolution method that has been efficiently applied in many different fields, such as process analysis, environmental data and, more recently, hyperspectral image analysis. When applied to second order data (or to three-way data) arrays, recovery of the underlying basis vectors in both measurement orders (i.e. signal and concentration orders) from the data matrix can be achieved without ambiguities if the trilinear model constraint is considered during the ALS optimization. This work summarizes different protocols of MCR-ALS application, presenting a case study: near-infrared image spectroscopy.

SÍNTESE E CARACTERIZAÇÃO DE COMPÓSITOS ORGÂNICO-INORGÂNICOS MACROPOROSOS PARA O SENSORIAMENTO DE H2O2

Electrodes modified with poly(5-amino-1-naphthol)/Prussian blue (poly(5-NH2-1-NAP)/PB) hybrid films are able to electrochemically reduce H2O2 in medium containing an excess of Na+ cations. This is an important advantage for biosensing applications over electrodes in which only conventionally (electro) deposited Prussian blue is present. Consequently, the aim of this work was to examine the application of templates of ordered arrays of colloidal poly(styrene) spheres (800, 450 and 100 nm in diameter) to produce inverse opal structures of poly(5-NH2-1-NAP)/PB hybrid platforms, in an effort to study the influence of the increase in surface area/volume ratio and higher exposition of the mediator active sites on material performance during H2O2 determination employing the different sized porous structures. Moreover, since the accentuated hydrophilic character of poly(5-NH2-1-NAP)/PB also allows H2O2 electrochemical reduction in inner active sites, issues concerning the amount of mediator electrodeposited on the electrode were also reflected in the observed results.