Loss of Ovarian Function Results in Increased Loss of Skeletal Muscle in Arthritic Rats

Objective We studied the effects of loss of ovarian function (ovariectomy) onmuscle mass of gastrocnemius and themRNA levels of IGF-1, atrogin-1, MuRF-1, andmyostatin in an experimental model of rheumatoid arthritis in rats. Methods We randomly allocated 24 female Wistar rats (9 weeks, 195.3±17.4 grams) into four groups: control (CT-Sham; n = 6); rheumatoid arthritis (RA; n = 6); ovariectomy without rheumatoid arthritis (OV; n = 6); ovariectomy with rheumatoid arthritis (RAOV; n = 6). We performed the ovariectomy (OV and RAOV) or Sham (CTSham or RA) procedures at the same time, fifteen days before the rheumatoid arthritis induction. The RA and RAOV groups were immunized and then were injected with Met- BSA in the tibiotarsal joint. After 15 days of intra-articular injections the animals were euthanized. We evaluated the external manifestations of rheumatoid arthritis (perimeter joint) as well as animal weight, and food intake throughout the study. We also analyzed the cross-sectional areas (CSA) of gastrocnemius muscle fibers in 200 fibers (H&E method). In the gastrocnemius muscle, we analyzed mRNA expression by quantitative real time PCR followed by the Livak method (ΔΔCT). Results The rheumatoid arthritis induced reduction in CSA of gastrocnemius muscle fibers. The RAOV group showed a lower CSA of gastrocnemius muscle fibers compared to RA and CT-Sham groups. Skeletal muscle IGF-1 mRNA increased in arthritics and ovariectomized rats. The increased IGF-1 mRNA was higher in OV groups than in the RA and RAOV groups. Antrogin-1 mRNA also increased in the gastrocnemius muscle of arthritic and ovariectomized rats. However, the increased atrogin-1 mRNA was higher in RAOV groups than in the RA and OV groups. Gastrocnemius muscle MuRF-1 mRNA increased in the OVand RAOVgroups, but not in the RA and Shamgroups. However, the RAOV group showed higher MuRF-1 mRNA than the OV group. The myostatin gene expression was similar in all groups. Conclusion Loss of ovarian function results in increased loss of skeletal musclerelated ubiquitin ligases atrogin-1 and MuRF-1 in arthritic rats.

Age-related changes of the multidrug resistance P-glycoprotein function in normal human peripheral blood T lymphocytes

The multidrug resistance P-glycoprotein is a transmembrane efflux pump expressed by lymphocytes and is involved in their cytolytic activity. In the present study, we investigated the age-related changes of P-glycoprotein function in normal peripheral blood lymphocytes. Blood samples from 90 normal volunteers (age range, 0 to 86 years) were analyzed. P-glycoprotein function was assessed by the flow cytometric rhodamine 123 assay. P-glycoprotein function was highest in cord blood and progressively declined with age in peripheral blood T CD4+ and CD8+ cells. In contrast, P-glycoprotein function did not vary with age in CD19+ B or CD16+CD56+ natural killer cells. These data suggest that the decline in P-glycoprotein function in T CD4+ and CD8+ lymphocytes as a function of age may contribute to the decrease in T cell cytolytic activity with aging.

Effect of chronic fish oil supplementation on renal function of normal and cachectic rats

In the present study we determined the effect of chronic diet supplementation with n-3 PUFA on renal function of healthy and cachectic subjects by providing fish oil (1 g/kg body weight) to female rats throughout pregnancy and lactation and then to their offspring post-weaning and examined its effect on renal function parameters during their adulthood. The animals were divided into four groups of 5-10 rats in each group: control, control supplemented with fish oil (P), cachectic Walker 256 tumor-bearing (W), and W supplemented with fish oil (WP). Food intake was significantly lower in the W group compared to control (12.66 ± 4.24 vs 25.30 ± 1.07 g/day). Treatment with fish oil significantly reversed this reduction (22.70 ± 2.94 g/day). Tumor growth rate was markedly reduced in the P group (16.41 ± 2.09 for WP vs 24.06 ± 2.64 g for W). WP group showed a significant increase in mean glomerular filtration rate compared to P and control (1.520 ± 0.214 ml min-1 kg body weight-1; P < 0.05). Tumor-bearing groups had low urine osmolality compared to control rats. The fractional sodium excretion decreased in the W group compared to control (0.43 ± 0.16 vs 2.99 ± 0.87%; P < 0.05), and partially recovered in the WP group (0.90 ± 0.20%). In summary, the chronic supplementation with fish oil used in this study increased the amount of fat in the diet by only 0.1%, but caused remarkable changes in tumor growth rate and cachexia, also showing a renoprotective function.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Labeling of Salmonella Typhymurium with iodine-131 to study phagocytic function in rats

The present study describes a method for labeling Salmonella typhymurium with iodine-131 to evaluate both the morphological and the functional characteristics of the reticulo-endothelial system. A suspension containing 2 x 10(9) bacteria per ml was labeled with carrier-free Na131I without reductor, with a labeling yield of 46.5 ± 3% and 3.5 ± 1.3% of free Iodine-131. The biodistribution of the labeled bacteria in rats was studied with a large field-of-view scintillation camera equiped with a pinhole collimator. Whole body images were obtained 15 and 30 minutes after intravenous injection of the labeled microorganisms. Images showed accumulation of bacteria in the liver and both normal and transplanted spleens of the animals. Autoradiographs of liver and spleen demonstrated labeled bacteria within the cells of the reticulo-endothelial system. The method described is easy to perform, has a good labeling yield and allows the functional evaluation of the reticulo-monophagocytic system, including transplanted spleens.

Lymphocyte subpopulations and neutrophil function in chronic human Chagas' disease

The absolute numbers of total leukocytes, lymphocytes, T cells, helper/inducer, suppressor/cytotoxic and B cells were decreased in the peripheral blood of patients with chronic Chagas' disease. Since antilymphocyte antibodies were present only in a minority of patients they probably cannot account for the abnormalities in lymphocyte subsets. Patient neutrophils stimulated with endotoxin-treated autologous plasma showed depressed chemotactic activity and this seems to be an intrinsic cellular defect rather than plasma inhibition. Random migration of neutrophils was normal. Reduction of nitroblue tetrazolium by endotoxin- stimulated neutrophils was also decreased. These findings further document the presence of immunosuppression in human Chagas' disease. They may be relevant to autoimmunity, defense against microorganisms and against tumor cells at least in a subset of patients with more severe abnormalities.

Adrenal function in 23 children with paracoccidioidomycosis

Adrenal involvement by Paracoccidioides brasiliensis was described at necropsies and in many clinical studies, but only in adults. Therefore, the aim of this study was to evaluate adrenal function in children with paracoccidioidomycosis. Twenty-three children with the systemic form of paracoccidioidomycosis were evaluated and divided in two Groups: Group A (n = 8) included children before treatment and Group B (n = 15) children after the end of treatment. Plasma cortisol (basal and after ACTH test), ACTH, renin activity, aldosterone, sodium and potassium were measured. They were within normal range in all cases, except for renin activity and aldosterone, which were elevated in some cases. Group A patients showed basal and post-ACTH cortisol levels significantly greater than Group B patients. The results showed that adrenal function was not compromised in these children with paracoccidioidomycosis.

Liver function evaluation in leptospirosis with colloidal gold 1 9 8 Au

Eight patients with leptospirosis were studied with colloidal gold 1 9 8 Au. The radiocolloidal hepatic distribution was altered, presenting a non-homogeneous tiver concentration in seven cases, and a minute to moderate splenic visualization in five. Two patients presented doubtful splenic image, and one seemed to be normal. Liver scanning with colloidal gold 1 9 8 Au is demonstra ted to be a good liver function test.

Differing phagocytic function of monocytes and neutrophils in Chagas' cardiopathy according to the presence or absence of congestive heart failure

We evaluated the in vitro phagocytic function and the production of microbicidal oxygen radicals by monocytes and neutrophils of 9 Chagas' heart disease subjects with heart failure and 9 without the syndrome in comparison with 11 healthy subjects, by assessing phagocytosis of Saccharomyces cerevisiae and NBT reduction by peripheral blood phagocytes. Phagocytic index of monocytes of chagasics without heart failure was significantly 6.7 and 10.6 times lower than those of controls and chagasics with the congestive syndrome, respectively, due to a lesser engagement in phagocytosis and to an inability of these cells to ingest particles. Neutrophils also show in chagasics without heart failure PI 11.2 and 19.8 times lower than that of controls and chagasics with heart failure, respectively. The percent of NBT reduction was normal and similar for the three groups. Balanced opposite effects of cardiovascular and immune disturbances may be acting in Chagas' disease subjects with heart failure paradoxically recovering the altered phagocytic function.

Liver synthesis function in chronic asymptomatic or oligosymptomatic alcoholics: correlation with other liver tests

Liver function and its correlation with bilirubin and hepatic enzymes were evaluated in 30 male chronic asymptomatic or oligosymptomatic alcoholics admitted into the psychiatric hospital for detoxification and treatment of alcoholism. Hypoalbuminemia, lowered prothrombin activity, hypotransferrinemia and hypofibrinogenemia were detected in 32 %, 32 %, 28 %, and 24 % of patients, respectively. Transferrin was elevated in 8 %. Greater prevalence of hyperbilirubinemia was found in patients with lowered prothrombin activity, hypofibrinogenemia, or hypotransferrinemia. No correlation was found between serum bilirubin or aminotransferase levels and normal or elevated albumin levels, time or activity of prothrombin, and fibrinogen levels. Serum alkaline phosphatase was elevated in normoalbuminemics and gamma-glutamyltransferase in patients with lowered prothrombin activity. Hypoalbuminemia was associated with hypofibrinogenemia, hypotransferrinemia with elevated aspartate aminotransferase or gamma-glutamyltransferase, and hypertransferrinemia with elevation of alanine aminotransferase. These data indicated the occurrence of hepatic dysfunction due to liver damage caused directly by alcohol or by alcoholism-associated nutritional deficiencies.

Cystic fibrosis with normal sweat chloride concentration: case report

Cystic fibrosis is a genetic disease usually diagnosed by abnormal sweat testing. We report a case of an 18-year-old female with bronchiectasis, chronic P. aeruginosa infection, and normal sweat chloride concentrations who experienced rapid decrease of lung function and clinical deterioration despite treatment. Given the high suspicion ofcystic fibrosis, broad genotyping testing was performed, showing a compound heterozygous with deltaF508 and 3849+10kb C->T mutations, therefore confirming cystic fibrosis diagnosis. Although the sweat chloride test remains the gold standard for the diagnosis of cystic fibrosis, alternative diagnostic tests such as genotyping and electrophysiologic measurements must be performed if there is suspicion of cystic fibrosis, despite normal or borderline sweat chloride levels.

Effects of protein-calorie restriction on mechanical function of hypertrophied cardiac muscle

OBJECTIVE: To assess the effect of food restriction (FR) on hypertrophied cardiac muscle in spontaneously hypertensive rats (SHR). METHODS: Isolated papillary muscle preparations of the left ventricle (LV) of 60-day-old SHR and of normotensive Wistar-Kyoto (WKY) rats were studied. The rats were fed either an unrestricted diet or FR diet (50% of the intake of the control diet) for 30 days. The mechanical function of the muscles was evaluated through monitoring isometric and isotonic contractions. RESULTS: FR caused: 1) reduction in the body weight and LV weight of SHR and WKY rats; 2) increase in the time to peak shortening and the time to peak developed tension (DT) in the hypertrophied myocardium of the SHR; 3) diverging changes in the mechanical function of the normal cardiac muscles of WKY rats with reduction in maximum velocity of isotonic shortening and of the time for DT to decrease 50% of its maximum value, and increase of the resting tension and of the rate of tension decline. CONCLUSION: Short-term FR causes prolongation of the contraction time of hypertrophied muscles and paradoxal changes in mechanical performance of normal cardiac fibers, with worsening of the shortening indices and of the resting tension, and improvement of the isometric relaxation.

Contribution of Doppler echocardiography to the evaluation of systolic and diastolic function of obese women versus a control group

OBJECTIVE: To study by doppler echocardiography the cardiac systolic and diastolic functions of health, uncomplicated obese subjects. METHODS: Fifty-nine obese women with an average body mass index (BMI) of 35 kg/m² were evaluated and compared with 19 subjects with an average BMI of 23 kg/m² (control group). RESULTS: In the obese group, a clear tendency was observed toward higher systolic pressure, increased wall thickness and, consequently, myocardial mass, elevation on the circumference stress of the left ventricular wall, and an indisputable presence of diastolic abnormalities. Filling abnormalities were observed with impaired relaxation, with prolonged isovolumic relaxation time (IVRT) and augmented atrium contribution representing early indexes of cardiac dysfunction when systolic performance is still normal. CONCLUSION: Obesity is generally a chronic condition, and doppler echocardiography can be used as a noninvasive instrument for early evaluation of left ventricular diastolic indexes.

Left Ventricular Diastolic Function in Essential Hypertensive Patients: Influence of Age and Left Ventricular Geometry

PURPOSE - To evaluate diastolic dysfunction (DD) in essential hypertension and the influence of age and cardiac geometry on this parameter. METHODS - Four hundred sixty essential hypertensive patients (HT) underwent Doppler echocardiography to obtain E/A wave ratio (E/A), atrial deceleration time (ADT), and isovolumetric relaxation time (IRT). All patients were grouped according to cardiac geometric patterns (NG - normal geometry; CR - concentric remodeling; CH- concentric hypertrophy; EH - eccentric hypertrophy) and to age (<40; 40 - 60; >60 years). One hundred six normotensives (NT) persons were also evaluated. RESULTS - A worsening of diastolic function in the HT compared with the NT, including HT with NG (E/A: NT - 1.38±0.03 vs HT - 1.27±0.02, p<0.01), was observed. A higher prevalence of DD occurred parallel to age and cardiac geometry also in the prehypertrophic groups (CR). Multiple regression analysis identified age as the most important predictor of DD (r²=0.30, p<0.01). CONCLUSION - DD was prevalent in this hypertensive population, being highly affected by age and less by heart structural parameters. DD is observed in incipient stages of hypertensive heart disease, and thus its early detection may help in the risk stratification of hypertensive patients.

Doppler tissue imaging to assess systolic function in Chagas' disease

OBJECTIVE: To assess the usefulness of Doppler tissue imaging (DTI) for evaluating the systolic function of chagasic patients with and without electrocardiographic abnormalities, in comparision with echocardiographic study. METHODS: We studied 77 patients divided into 3 groups as follows: group 1 - control; group 2 - chagasic patients with normal electrocardiographic findings; and group 3 - chagasic patients with abnormal electrocardiographic findings. The following parameters were assessed: left ventricular dimensions and ejection fraction, left atrial dimensions and diastolic function on echocardiography. Systolic velocity and regional isovolumic contraction time (IVCTr) of the septal, anterior, lateral, posterior and inferior left ventricular walls were assessed on DTI. RESULTS: Left ventricular cavitary dimensions, ejection fraction and DTI systolic wave showed significant differences between groups 1 and 3 and between groups 2 and 3, which were not found between groups 1 and 2. IVCTr allowed a statistically significant discrimination among the 3 groups. CONCLUSION: DTI allowed discrimination among the different groups assessed, being superior to echocardiography in identifying early abnormalities of contractility, and, therefore, potentially useful for detecting incipient myocardial alterations in chagasic patients with normal electrocardiographic findings.