A closer look at multiple-clone Plasmodium vivax infections: detection methods, prevalence and consequences

The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.

Quantification of the genetic change in the transition of Rhodnius pallescens Barber, 1932 (Hemiptera: Reduviidae) from field to laboratory

Previous studies have reported genetic differences between wild-caught sylvatic, domestic and laboratory pop-ulations of several Triatominae species. The differences between sylvatic and laboratory colonies parallel are similar to the differences observed between sylvatic and domestic populations. Laboratory colonies are frequently used as references for field populations, but the consequences of founder events on the genetic makeup of laboratory or domestic populations are rarely quantified. Our goal was to quantify the genetic change in Rhodnius pallescens populations artificially submitted to founder effects via laboratory colonization. We compared the genetic makeup of two sylvatic populations and their laboratory descendants using a panel of 10 microsatellite markers. Both sylvatic populations were initially collected from palm trees, but the colonies differed in the number of founder insects and amount of time kept in the laboratory. We evaluated allelic polymorphism, differences between expected and observed heterozygosity, estimates of population differentiation (Fst) and inbreeding (Fis, Fit) and cluster analyses based on Nei's distances. We found a unique genetic structure for each sample population, with significant differentiation between the field insects and each of the laboratory generations. These analyses showed strong founder effects and showed that genetic drift had led to a genetic equilibrium over several generations of isolation. Our results suggest that laboratory colonies of R. pallescens have a different genetic structure than their wild relatives and similar processes likely affect other Triatominae laboratory stocks.

Trypanosoma cruzi benznidazole susceptibility in vitro does not predict the therapeutic outcome of human Chagas disease

Therapeutic failure of benznidazole (BZ) is widely documented in Chagas disease and has been primarily associated with variations in the drug susceptibility of Trypanosoma cruzi strains. In humans, therapeutic success has been assessed by the negativation of anti-T. cruzi antibodies, a process that may take up to 10 years. A protocol for early screening of the drug resistance of infective strains would be valuable for orienting physicians towards alternative therapies, with a combination of existing drugs or new anti-T. cruzi agents. We developed a procedure that couples the isolation of parasites by haemoculture with quantification of BZ susceptibility in the resultant epimastigote forms. BZ activity was standardized with reference strains, which showed IC50 to BZ between 7.6-32 µM. The assay was then applied to isolates from seven chronic patients prior to administration of BZ therapy. The IC50 of the strains varied from 15.6 ± 3-51.4 ± 1 µM. Comparison of BZ susceptibility of the pre-treatment isolates of patients considered cured by several criteria and of non-cured patients indicates that the assay does not predict therapeutic outcome. A two-fold increase in BZ resistance in the post-treatment isolates of two patients was verified. Based on the profile of nine microsatellite loci, sub-population selection in non-cured patients was ruled out.

Molecular markers and genetic diversity of Plasmodium vivax

Enhanced understanding of the transmission dynamics and population genetics for Plasmodium vivax is crucial in predicting the emergence and spread of novel parasite phenotypes with major public health implications, such as new relapsing patterns, drug resistance and increased virulence. Suitable molecular markers are required for these population genetic studies. Here, we focus on two groups of molecular markers that are commonly used to analyse natural populations of P. vivax. We use markers under selective pressure, for instance, antigen-coding polymorphic genes, and markers that are not under strong natural selection, such as most minisatellite and microsatellite loci. First, we review data obtained using genes encoding for P. vivax antigens: circumsporozoite protein, merozoite surface proteins 1 and 3α, apical membrane antigen 1 and Duffy binding antigen. We next address neutral or nearly neutral molecular markers, especially microsatellite loci, providing a complete list of markers that have already been used in P. vivax populations studies. We also analyse the microsatellite loci identified in the P. vivax genome project. Finally, we discuss some practical uses for P. vivax genotyping, for example, detecting multiple-clone infections and tracking the geographic origin of isolates.

The persistence of multifocal colonisation by a single ABC genotype of Candida albicans may predict the transition from commensalism to infection

Candida albicans is a common member of the human microbiota and may cause invasive disease in susceptible populations. Several risk factors have been proposed for candidaemia acquisition. Previous Candida multifocal colonisation among hospitalised patients may be crucial for the successful establishment of candidaemia. Nevertheless, it is still not clear whether the persistence or replacement of a single clone of C. albicans in multiple anatomical sites of the organism may represent an additional risk for candidaemia acquisition. Therefore, we prospectively evaluated the dynamics of the colonising strains of C. albicans for two groups of seven critically ill patients: group I included patients colonised by C. albicans in multiple sites who did not develop candidaemia and group II included patients who were colonised and who developed candidaemia. ABC and microsatellite genotyping of 51 strains of C. albicans revealed that patients who did not develop candidaemia were multiply colonised by at least two ABC genotypes of C. albicans, whereas candidaemic patients had highly related microsatellites and the same ABC genotype in colonising and bloodstream isolates that were probably present in different body sites before the onset of candidaemia.

Genetic diversity of chloroquine-resistant Plasmodium vivax parasites from the western Brazilian Amazon

The molecular basis of Plasmodium vivax chloroquine (CQ) resistance is still unknown. Elucidating the molecular background of parasites that are sensitive or resistant to CQ will help to identify and monitor the spread of resistance. By genotyping a panel of molecular markers, we demonstrate a similar genetic variability between in vitro CQ-resistant and sensitive phenotypes of P. vivax parasites. However, our studies identified two loci (MS8 and MSP1-B10) that could be used to discriminate between both CQ-susceptible phenotypes among P. vivax isolates in vitro. These preliminary data suggest that microsatellites may be used to identify and to monitor the spread of P. vivax-resistance around the world.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Characterization of mandarin citrus germplasm from Southern Brazil by morphological and molecular analyses

The objective of this work was to characterize mandarin (Citrus spp.) germplasm from Southern Brazil by morphological and molecular analyses. Thirty seven cultivars from 34 distinct mandarin varieties were evaluated by morphological and agronomic traits of leaves, flowers and fruits, and by microsatellite markers. The morphological and agronomic characteristics suggested that almost all varieties can be produced for commercial use, and some, as the Satsuma variety, are recommended for breeding programs. Pooled DNA samples from 1-5 plants belonging to each cultivar were tested. Eight of the nine primers detected polymorphisms. Specific markers were found for some accessions. The dendrogram constructed with the morphological results divided the 37 cultivars into four groups, while that obtained with the microsatellites clustered 35 of the 37 cultivars into three groups only. Generally, intervarietal differences are not high, and this lack of agreement in the two multifactorial analyses indicates that diverse evolutionary factors are acting at these two levels of investigation.

Study of simple sequence repeat markers from coffee expressed sequences associated to leaf miner resistance

The objective of this work was to identify expressed simple sequence repeats (SSR) markers associated to leaf miner resistance in coffee progenies. Identification of SSR markers was accomplished by directed searches on the Brazilian Coffee Expressed Sequence Tags (EST) database. Sequence analysis of 32 selected SSR loci showed that 65% repeats are of tetra-, 21% of tri- and 14% of dinucleotides. Also, expressed SSR are localized frequently in the 5'-UTR of gene transcript. Moreover, most of the genes containing SSR are associated with defense mechanisms. Polymorphisms were analyzed in progenies segregating for resistance to the leaf miner and corresponding to advanced generations of a Coffea arabica x Coffea racemosa hybrid. Frequency of SSR alleles was 2.1 per locus. However, no polymorphism associated with leaf miner resistance was identified. These results suggest that marker-assisted selection in coffee breeding should be performed on the initial cross, in which genetic variability is still significant.

Validation of microsatellite markers for assisted selection of soybean resistance to cyst nematode races 3 and 14

The objective of this work was to validate microsatellite markers associated with resistance to soybean cyst nematode (Heterodera glycines Ichinohe) races 3 and 14, in soybean (Glycine max L.) genotypes, for use in marker-assisted selection (MAS) programs. Microsatellites of soybean linkage groups A2, D2 and G were tested in two populations, and their selection efficiencies were determined. The populations were 65 F2:3 families from Msoy8001 (resistant) x Conquista (susceptible) cross, and 66 F2:3 families of S5995 (resistant) x Renascença (susceptible) cross, evaluated for resistance to races 3 and 14, respectively. Families with female index up to 30% were considered moderately resistant. Markers of A2 and G linkage groups were associated with resistance to race 3. Markers Satt309 and GMENOD2B explained the greatest proportion of phenotypic variance in the different groups. The combinations Satt309+GMENOD2B and Satt309+Satt187 presented 100% selection efficiency. Resistance to race 14 was associated with markers of G linkage group, and selection efficiency in the Satt309+Satt356 combination was 100%. The selection differential obtained by phenotypic and marker assisted selection showed that both can result in similar gains.

Genetic diversity of Brazilian Pantaneiro horse and relationships among horse breeds

The objective of this work was to evaluate the genetic diversity of Brazilian Pantaneiro horse by microsatellite markers, investigate the effect of genetic bottlenecks and estimate genetic differentiation among four horse breeds. Genetic variation was estimated through allele frequencies and mean breed heterozygosity. Nei's genetic distances among the breeds Pantaneiro, Thoroughbred, Arabian, Spanish Pure Breed (Andalusian), and Uruguay Creole were calculated, and it was used to construct an UPGMA dendrogram. Clustering at different K values was calculated to infer population structure and assign individuals to populations. Nei's distances showed a minimum distance between Pantaneiro horse and Spanish Pure Breed (0.228), and similar distances from Spanish Pure Breed to Thoroughbred and to Arabian (0.355 and 0.332). It was observed a great level of diversity, clear distance from Pantaneiro horse to other breeds, and genetic uniformity within breed. It was verified a certain level of substructure of Pantaneiro horse showing no influences from the other studied breeds.

Genetic variability of Brazilian rice landraces determined by SSR markers

The objective of this study was to evaluate the genetic variability of rice (Oryza sativa) landraces collected in Brazilian small farms. Twelve simple sequence repeat (SSR) markers characterized 417 landraces collected in 1986, 1987 and 2003, in the state of Goiás, Brazil. The number of landraces with long and thin grain type increased in the evaluated period, probably due to market demand. Based on the molecular data, the genetic variability increased during this period and, as per to the factorial correspondence analysis, most of the accessions were grouped according to the year of collection. The incorporation of modern rice cultivars in landrace cultivation areas and the selection carried out by small farmers are the most probable factors responsible for increasing landrace genetic variability, during the evaluated period. Genotype exchange between farmers, selection practice and local environmental adaptation are able to generate novel adapted allele combinations, which can be used by breeding programs, to reinitiate the process.

Potato cultivar identification using molecular markers

The objective of this work was to evaluate a set of microsatellite markers for varietal identification and characterization of the most widespread potato cultivars in Brazil. The DNA from 14 potato cultivars was genotyped using microsatellite markers and the alleles were scored in silver-stained polyacrylamide gel. Twenty-four microsatellite markers were evaluated, and only one locus was monomorphic. Based on band patterns, a set of two microsatellites that were able to identify and differentiate all examined cultivars was obtained.

Development of herbicide-tolerant irrigated rice cultivars

The objective of this work was to develop new irrigated rice lines tolerant to imidazolinone herbicides. The backcross breeding procedure was used to transfer the imidazolinone tolerance allele from mutant 93AS3510 to the recurrent parents 'BRS 7 Taim' and 'BRS Pelota'. Individual herbicide-tolerant plants were selected in each generation, for three backcrossings (RC1 to RC3), followed by three selfing generations (RC3F1 to RC3F3). The best four RC3F3 lines for agronomic traits were genotyped with 44 microsatellite markers. The observed conversion index of the new imidazolinone-tolerant lines varied from 91.86 to 97.67%. Pairwise genetic distance analysis between these lines and 22 accessions from the Embrapa's Rice Germplasm Bank clustered the new lines with their respective recurrent parents, but not with 'IRGA 417', which was originally used as recurrent parent to derive IRGA 422 CL, the only imidazolinone-tolerant irrigated rice cultivar recommended for cultivation in Brazil. Therefore, these lines represent new options of genetically diverse imidazolinone-tolerant rice accessions. Lines CNA10756 ('BRS Sinuelo CL') and CNA10757 will be released for cultivation in the Clearfield irrigated rice production system in Rio Grande do Sul, Brazil.

QTLs for resistance to soybean cyst nematode, races 3, 9, and 14 in cultivar Hartwig

The objective of this work was to identify major and minor-effect quantitative trait loci (QTL) for resistance to races 3, 9, and 14 of soybean cyst nematode (SCN) in Hartwig cultivar; to map new resistance QTLs for these races; and to check for the existence of epistatic interactions between QTLs. Cultivar Hartwig is an important resistance source to SCN. Recombinant inbred lines (RIL) obtained from a cross between 'Hartwig' (resistant) and Y23 (susceptible) were evaluated regarding resistance to the three races. New genomic regions for resistance to SCN were identified by microsatellites. Four QTLs, which explained between 12 and 34% of phenotypic variance, were detected for resistance to race 3 in linkage groups (LG) A2, G, J, and M. The QTL in LG G is also important for resistance to race 9. Epistatic interactions were detected between loci, which indicate resistance to races 9 and 14. There are high and low-effect resistance QTLs to SCN.