Human bocavirus 1 and 3 infection in children with acute gastroenteritis in Brazil

To determine the positivity rate of human bocavirus (HBoV) 1 and 3 among children who presented with acute gastroenteritis symptoms during the period of 1994-2004 in the Central-West Region of Brazil, 762 faecal samples were tested using polymerase chain reaction (PCR) for the detection of HBoV DNA. Primers for a segment of the non-structural viral protein 1 (NS1) gene of HBoV-1 and HBoV-3 were used. Twelve HBoV-positive samples were further characterised via genomic sequencing and phylogenetic analysis. Of the samples tested, 5.8% (n = 44) were positive for HBoV-1 or HBoV-3 and co-infection was observed in 14 (31.8%) of the 44 HBoV-positive samples. Nine of the 14 samples were also positive for Rotavirus A and five were positive for Aichi virus. The genomic sequencing of the NS1 partial sequence of 12 HBoV-samples showed that 11 samples were characterised as HBoV-1 and that one was characterised as HBoV-3. The phylogenetic analysis showed that the HBoV-1 samples had a high sequence homology to others previously identified in China, Sweden and Brazil. This is the first study conducted in the Central-West Region of Brazil to detect HBoV-1 and HBoV-3 in faecal samples from children with acute gastroenteritis. Further studies are required to define the role of HBoVs as aetiological agents of gastroenteritis.

Zika virus damages the human placental barrier and presents marked fetal neurotropism

An unusually high incidence of microcephaly in newborns has recently been observed in Brazil. There is a temporal association between the increase in cases of microcephaly and the Zika virus (ZIKV) epidemic. Viral RNA has been detected in amniotic fluid samples, placental tissues and newborn and fetal brain tissues. However, much remains to be determined concerning the association between ZIKV infection and fetal malformations. In this study, we provide evidence of the transplacental transmission of ZIKV through the detection of viral proteins and viral RNA in placental tissue samples from expectant mothers infected at different stages of gestation. We observed chronic placentitis (TORCH type) with viral protein detection by immunohistochemistry in Hofbauer cells and some histiocytes in the intervillous spaces. We also demonstrated the neurotropism of the virus via the detection of viral proteins in glial cells and in some endothelial cells and the observation of scattered foci of microcalcifications in the brain tissues. Lesions were mainly located in the white matter. ZIKV RNA was also detected in these tissues by real-time-polymerase chain reaction. We believe that these findings will contribute to the body of knowledge of the mechanisms of ZIKV transmission, interactions between the virus and host cells and viral tropism.

Celiac plexus block: an anatomical study and simulation using computed tomography

Objective: To analyze anatomical variations associated with celiac plexus complex by means of computed tomography simulation, assessing the risk for organ injury as the transcrural technique is utilized. Materials and Methods: One hundred eight transaxial computed tomography images of abdomen were analyzed. The aortic-vertebral, celiac trunk (CeT)-vertebral, CeT-aortic and celiac-aortic-vertebral topographical relationships were recorded. Two needle insertion pathways were drawn on each of the images, at right and left, 9 cm and 4.5 cm away from the midline. Transfixed vital organs and gender-related associations were recorded. Results: Aortic-vertebral - 45.37% at left and 54.62% in the middle; CeT-vertebral - T12, 36.11%; T12-L1, 32.4%; L1, 27.77%; T11-T12, 2.77%; CeT-aortic - 53.7% at left and 46.3% in the middle; celiac-aortic-vertebral - L-l, 22.22%; M-m, 23.15%; L-m, 31.48%; M-l, 23.15%. Neither correspondence on the right side nor significant gender-related associations were observed. Conclusion: Considering the wide range of abdominal anatomical variations and the characteristics of needle insertion pathways, celiac plexus block should not be standardized. Imaging should be performed prior to the procedure in order to reduce the risks for injuries or for negative outcomes to patients. Gender-related anatomical variations involved in celiac plexus block should be more deeply investigated, since few studies have addressed the subject.

Ultrasonographic study and Doppler flow velocimetry of maternal kidneys and liver in low-risk pregnancy

AbstractObjective:Longitudinal study with B-mode ultrasonography and Doppler ultrasonography of maternal kidneys and liver in low-risk pregnancy, to establish and quantify normality parameters, correlating them with physiological changes.Materials and Methods:Twenty-five pregnant women were assessed and selected to participate in the study, each of them undergoing four examinations at the first, second, third trimesters and postpartum.Results:Findings during pregnancy were the following: increased renal volume, pyelocaliceal dilatation with incidence of 45.4% in the right kidney, and 9% in the left kidney; nephrolithiasis, 18.1% in the right kidney, 13.6% in the left kidney. With pyelocaliceal dilatation, mean values for resistivity index were: 0.68 for renal arteries; 0.66 for segmental arteries; 0.64 for interlobar arteries; 0.64 for arcuate arteries. Without pyelocaliceal dilatation, 0.67 for renal arteries; 0.64 for segmental arteries; 0.63 for interlobar arteries; and 0.61 for arcuate arteries. Portal vein flow velocities presented higher values in pregnancy, with mean value for maximum velocity of 28.9 cm/s, and 22.6 cm/s postpartum. The waveform pattern of the right hepatic vein presented changes persisting in the postpartum period in 31.8% of the patients. Cholelithiasis was observed in 18.1% of the patients.Conclusion:Alterations in renal volume, pyelocaliceal dilatation, nephrolithiasis, cholelithiasis, changes in portal vein flow velocity, alterations in waveform pattern of the right hepatic vein, proved to be significant.

Anatomical and functional characteristics of the pelvic floor in nulliparous women submitted to three-dimensional endovaginal ultrasonography: case control study and evaluation of interobserver agreement

PURPOSE: To determine anatomical and functional pelvic floor measurements performed with three-dimensional (3-D) endovaginal ultrasonography in asymptomatic nulliparous women without dysfunctions detected in previous dynamic 3-D anorectal ultrasonography (echo defecography) and to demonstrate the interobserver reliability of these measurements. METHODS: Asymptomatic nulliparous volunteers were submitted to echo defecography to identify dynamic dysfunctions, including anatomical (rectocele, intussusceptions, entero/sigmoidocele and perineal descent) and functional changes (non-relaxation or paradoxical contraction of the puborectalis muscle) in the posterior compartment and assessed with regard to the biometric index of levator hiatus, pubovisceral muscle thickness, urethral length, anorectal angle, anorectal junction position and bladder neck position with the 3-D endovaginal ultrasonography. All measurements were compared at rest and during the Valsalva maneuver, and perineal and bladder neck descent was determined. The level of interobserver agreement was evaluated for all measurements. RESULTS: A total of 34 volunteers were assessed by echo defecography and by 3-D endovaginal ultrasonography. Out of these, 20 subjects met the inclusion criteria. The 14 excluded subjects were found to have posterior dynamic dysfunctions. During the Valsalva maneuver, the hiatal area was significantly larger, the urethra was significantly shorter and the anorectal angle was greater. Measurements at rest and during the Valsalva maneuver differed significantly with regard to anorectal junction and bladder neck position. The mean values for normal perineal descent and bladder neck descent were 0.6 cm and 0.5 cm above the symphysis pubis, respectively. The intraclass correlation coefficient ranged from 0.62-0.93. CONCLUSIONS: Functional biometric indexes, normal perineal descent and bladder neck descent values were determined for young asymptomatic nulliparous women with the 3-D endovaginal ultrasonography. The method was found to be reliable to measure pelvic floor structures at rest and during Valsalva, and might therefore be suitable for identifying dysfunctions in symptomatic patients.

Human papillomavirus infection and p53 protein expression in vulvar intraepithelial neoplasia and invasive squamous cell carcinoma

The etiopathogenesis of vulvar intraepithelial neoplasia (VIN III) and invasive squamous cell carcinoma are largely unknown. Since there are few studies on Brazilian patients, our purpose was to determine the frequency of human papillomavirus (HPV) infection and the expression of p53 in these lesions, and associate them with other factors such as age, morphological subtypes, multicentric and multifocal disease. Thirty-eight cases of VIN III, nine of superficially invasive carcinoma, and 55 of invasive vulvar carcinoma were retrospectively evaluated from 1983 to 1995 for the presence of HPV by immunohistochemistry and in situ hybridization, and for p53 protein expression by immunohistochemistry on paraffin sections. All cases for whom material (slides and paraffin blocks) and clinical data were available were included. HPV and p53 were detected in 57.9 and 21.1% of the VIN III lesions, 33.3 and 66.7% of superficially invasive carcinomas, and 7.3 and 58.2% of invasive squamous cell carcinomas, respectively. HPV infection was associated with younger age in the VIN III and invasive carcinoma groups. In the latter, HPV infection was associated with the basaloid variant. p53 expression rate was higher in superficially invasive and invasive lesions and was not related to HPV infection. Our findings are similar to others and support the hypothesis that there are two separate entities of the disease, one associated with HPV and the other unrelated, with p53 inactivation possibly being implicated in some of the cases.

Human papillomavirus infection and its association with cervical dysplasia in Ecuadorian women attending a private cancer screening clinic

Women living in Latin American countries bear a disproportionate burden of cervical cancer, a condition caused by infection with the human papillomavirus (HPV). We performed a study in Santa Elena, Guayas (currently Santa Elena Province), Ecuador, to determine how often HPV could be detected in women attending a private cancer screening clinic. Participants underwent a Pap test, and vaginal and cervical swabs were performed for HPV testing by the polymerase chain reaction (PCR). Each participant completed a verbally administered survey. The mean age of 302 participants was 37.7 years (range 18 to 78 years). The majority of cervical and vaginal specimens contained sufficient DNA to perform PCR. Overall, 24.2% of the participants had either a cervical or vaginal swab that tested positive for HPV. In general, there was a good correlation between the HPV types detected in the cervical and vaginal swabs from the participants, but vaginal swabs were more likely to contain HPV DNA than were cervical swabs. The high-risk HPV types 16, 52, 58, and 59 and the low-risk HPV types 62, 71, 72, and 83 were the most frequently detected HPV types. The number of lifetime sexual partners was positively associated with detection of any HPV type, detection of oncogenic HPV, and abnormal Pap smears. Further studies are needed to determine if these results are representative of all Ecuadorian women and to determine if cervical cancers in Ecuadorian women are caused by the same HPV types found in the swab specimens obtained in this study.

Human papillomavirus detection and p16 methylation pattern in a case of esophageal papilloma

Esophageal cancer is a prevalent cancer worldwide. Some studies have reported the possible etiology of human papillomavirus (HPV) in benign and malignant papillomas of the esophagus but the conclusions are controversial. In the present study, we investigated an esophageal papilloma from a 30-year-old male patient presenting aphasia. HPV DNA was detected by generic PCR using MY09/11 primers, and restriction fragment length polymorphism revealed the presence of HPV54, usually associated with benign genital lesions. Hypermethylation of the pINK4A gene was also investigated due to its relation to malignant transformation, but no modification was detected in the host gene. Except for an incipient reflux, no risk factors such as cigarette smoking, alcohol abuse or an infected sexual partner were recorded. Since esophageal lesions may have a malignant potential, HPV detection and typing are useful tools for patient follow-up.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Study on the growth promoting capacity of calf and fetal bovine serum for animal cells "in vitro" II: electrophoretic study and survey on the antiproteolytic activity of pools of calf and fetal bovine serum

Calf serum and fetal bovine serum present great variability as to its growth promoting efficiency (GPE). As supplement of culture media to cultivate cells of animal origin they stimulate the "in vitro" multiplication and maintain cell viability. When fourteen lots of calf sera of variable GPE had the total protein contents as well as the percentages of serum fractions determined, no significant differences that could possibly explain the variability of the GPE were observed. Evaluation of the antiproteolytic activity of nineteen lots of calf serum and eighteen serum lots of younger calves showed that the former exhibited lower antiproteolytic titers (1:40 to 1:80) than the latter (1:80 to 1:160). Twelve lots of fetal bovine serum studied in parallel, showed the highest concentration of antiproteolytic factors, with titers equal to 1:320. Sera of bovine origin, but not fetal sera, are usually heat-inactivated, what was demonstrated to be responsible for the decrease of the antiproteolytic activity of 75% of the lots tested. This could explain the inability of certain heat-inactivated sera in promoting multiplication of some cells "in vitro", as verified with primary monkey kidney cells. The results obtained in this study indicated the convenience of submiting each lot of serum to be introduced in cell culture to previous determination of its characteristics, such as growth promoting efficiency, antiproteolytic activity and also toxicity, absence of extraneous agents, etc., in order to minimize the possibility of using serum lots of questionable quality, thus preventing not only the loss of cell lines, but also undesirable and sometimes expensive delays.

HUMAN TOXOPLASMOSIS OUTBREAKS AND THE AGENT INFECTING FORM. FINDINGS FROM A SYSTEMATIC REVIEW

SUMMARY Toxoplasmosis, a worldwide highly prevalent zoonotic infection, is transmitted either by the oocysts, from water and soil, or the tissue cysts, in raw or undercooked infected meat, of Toxoplasma gondii. An ongoing debate is whether there are differences between the clinical and epidemiological characteristics of the outbreaks due to one or the other infective form of the agent. We performed a systematic review, recovering 437 reported outbreaks of which 38 were selected. They were complete reports containing ascribed Toxoplasma infecting form, and clinical and demographic data. There was no gender or age group selection in the outbreaks, which were described more often in the Americas. A large number of individuals were affected when oocysts, associated with soil and water contaminated with cat feces, were considered the transmission source. Onset of symptoms occurred early when the infection was ascribed to meat tissue cysts (11.4 ± 6.7 days) with sharpened temporal distribution of cases, while a broader and prolonged appearance of new cases was observed when oocysts in water were the source of the infection (20 ± 7 days, p < 0.001). Such information may be useful in the design and implementation of control strategies.

Cytotoxic evaluation of essential oil from Casearia sylvestris Sw on human cancer cells and erythrocytes

A Casearia sylvestris (Flacourtiaceae) é uma planta popularmente conhecida como "guaçatonga" e é usada por povos indígenas da América do sul (Brasil, Peru e Bolivia) no tratamento de muitas doenças, incluindo câncer. Estudos citotóxicos mostraram que esta planta apresenta um possível e interessante potencial antitumoral devido à presença de moléculas chamadas casearinas. Além disso, a composição do óleo essencial mostrou uma alta concentração de sesquiterpenos de alto potencial citotóxico. Neste trabalho, nós verificamos que o óleo essencial da C. sylvestris apresentou uma boa citotoxicidade seletiva contra as linhagens de células tumorais HeLa, A-549 and HT-29 (CD50 63,3, 60,7 e 90,6 µg.ml-1, respectivamente) quando comparada às células não-tumorais Vero (CD50 210,1 µg.ml-1) e macrófagos de camundongos (CD50 234,0 µg.ml-1). Além disso, o óleo causou hemólise em sete diferentes tipos de eritrócitos, indicando que a C. sylvestris precisa ser usada com cuidado. Também foram testados padrões de β-cariofileno e α-humuleno que mostraram citotoxicidade similar àquelas apresentadas pelo óleo, indicando que estes compostos podem ser os responsáveis pelos efeitos tóxicos que foram observados neste estudo.

Chronic murine myocarditis due to Trypanosoma cruzi: an ultrastructural study and immunochemical characterization of cardiac interstitial matrix

In an attempt to define the mouse-model for chronic Chagas' disease, a serological, histopathological and ultrastructural study as well as immunotyping of myocardium collagenic matrix were performed on Swiss mice, chronically infected with Trypanosoma cruzi strains: 21 SF and mambaí (Type II); PMN and Bolivia (Type III), spontaneously surviving after 154 to 468 days of infection. Haemagglutination and indirect immunofluorescence tests showed high titres of specific antibodies. The ultrastructural study disclosed the cellular constitution of the inflammatory infiltrate showing the predominance of monocytes, macrophages with intense phagocytic activity, fibroblasts, myofibroblasts and abundant collagen matrix suggesting the association of the inflammatory process with fibrogenesis in chronic chagasic cardiomyopathy. Artertolar and blood capillary alterations together with dissociation of cardiac cells from the capillary wall by edema and inflammation were related to ultrastructural lesions of myocardial cells. Rupture of parasitized cardiac myocells contribute to intensify the inflammatory process in focal areas. Collagen immunotyping showed the predominance of Types III and IV collagen. Collagen degradation and phagocytosis were present suggesting a reversibility of the fibrous process. The mouse model seems to be valuable in the study of the pathogenetic mechanisms in Chagas cardiomyopathy, providing that T. cruzi strains of low virulence and high pathogenecity are used.