Molecular markers and genetic diversity of Plasmodium vivax

Enhanced understanding of the transmission dynamics and population genetics for Plasmodium vivax is crucial in predicting the emergence and spread of novel parasite phenotypes with major public health implications, such as new relapsing patterns, drug resistance and increased virulence. Suitable molecular markers are required for these population genetic studies. Here, we focus on two groups of molecular markers that are commonly used to analyse natural populations of P. vivax. We use markers under selective pressure, for instance, antigen-coding polymorphic genes, and markers that are not under strong natural selection, such as most minisatellite and microsatellite loci. First, we review data obtained using genes encoding for P. vivax antigens: circumsporozoite protein, merozoite surface proteins 1 and 3α, apical membrane antigen 1 and Duffy binding antigen. We next address neutral or nearly neutral molecular markers, especially microsatellite loci, providing a complete list of markers that have already been used in P. vivax populations studies. We also analyse the microsatellite loci identified in the P. vivax genome project. Finally, we discuss some practical uses for P. vivax genotyping, for example, detecting multiple-clone infections and tracking the geographic origin of isolates.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Eucalyptus ESTs involved in mechanisms against plant pathogens and environmental stresses

Eucalypt plantation has high economical importance in Brazil; however, it has been attacked by various pathogens under different environmental stress conditions. Disease resistance and survival under unfavorable environmental conditions have revealed that the eucalypt has developed highly efficient defense systems. Here we show the results of the Eucalyptus ESTs Genome Project (FORESTs). Using the expressed sequence tags (ESTs) obtained by the Project, contigs of similar sequences from each cDNA library induced and not induced by stress agents were formed, and cDNA sequences similar to other already known molecules, such as plant-signaling molecules, phytoalexins, lignin biosynthesis pathways, PR-proteins and putative genes corresponding to enzymes involved in the detoxification of reactive oxygen species, were identified. We also present general considerations about the mechanisms of Eucalyptus defense against biotic and abiotic stresses. These data are of extreme importance for future eucalypt breeding programs aimed at developing plants with enhanced resistance against pathogens and environmental stresses.

pp-Blast: a "pseudo-parallel" Blast

We have developed a software called pp-Blast that uses the publicly available Blast package and PVM (parallel virtual machine) to partition a multi-sequence query across a set of nodes with replicated or shared databases. Benchmark tests show that pp-Blast running in a cluster of 14 PCs outperformed conventional Blast running in large servers. In addition, using pp-Blast and the cluster we were able to map all human cDNAs onto the draft of the human genome in less than 6 days. We propose here that the cost/benefit ratio of pp-Blast makes it appropriate for large-scale sequence analysis. The source code and configuration files for pp-Blast are available at http://www.ludwig.org.br/biocomp/tools/pp-blast.

Association of MICA gene polymorphisms with liver fibrosis in schistosomiasis patients in the Dongting Lake region

Major histocompatibility complex class I chain-related A (MICA) is a highly polymorphic gene located within the MHC class I region of the human genome. Expressed as a cell surface glycoprotein, MICA modulates immune surveillance by binding to its cognate receptor on natural killer cells, NKG2D, and its genetic polymorphisms have been recently associated with susceptibility to some infectious diseases. We determined whether MICA polymorphisms were associated with the high rate of Schistosoma parasitic worm infection or severity of disease outcome in the Dongting Lake region of Hunan Province, China. Polymerase chain reaction-sequence specific priming (PCR-SSP) and sequencing-based typing (SBT) were applied for high-resolution allele typing of schistosomiasis cases (N = 103, age range = 36.2-80.5 years, 64 males and 39 females) and healthy controls (N = 141, age range = 28.6-73.3 years, 73 males and 68 females). Fourteen MICA alleles and five short-tandem repeat (STR) alleles were identified among the two populations. Three (MICA*012:01/02, MICA*017 and MICA*027) showed a higher frequency in healthy controls than in schistosomiasis patients, but the difference was not significantly correlated with susceptibility to S. japonicum infection (Pc > 0.05). In contrast, higher MICA*A5 allele frequency was significantly correlated with advanced liver fibrosis (Pc < 0.05). Furthermore, the distribution profile of MICA alleles in this Hunan Han population was significantly different from those published for Korean, Thai, American-Caucasian, and Afro-American populations (P < 0.01), but similar to other Han populations within China (P > 0.05). This study provides the initial evidence that MICA genetic polymorphisms may underlie the severity of liver fibrosis occurring in schistosomiasis patients from the Dongting Lake region.

Restriction enzyme analysis of the human cytomegalovirus genome in specimens collected from immunodeficient patients in Belém, State of Pará, Brazil

INTRODUCTION: Human cytomegalovirus is an opportunistic betaherpesvirus that causes persistent and serious infections in immunodeficient patients. Recurrent infections occur due to the presence of the virus in a latent state in some cell types. It is possible to examine the virus using molecular methods to aid in the immunological diagnosis and to generate a molecular viral profile in immunodeficient patients. The objective of this study was to characterize cytomegalovirus genotypes and to generate the epidemiological and molecular viral profile in immunodeficient patients. METHODS: A total of 105 samples were collected from immunodeficient patients from the City of Belém, including newborns, hemodialysis patients, transplant recipients and HIV+ patients. An IgG and IgM antibody study was completed using ELISA, and enzymatic analysis by restriction fragment length polymorphism (RFLP) was performed to characterize viral genotypes. RESULTS: It was observed that 100% of the patients had IgG antibodies, 87% of which were IgG+/IgM-, consistent with a prior infection profile, 13% were IgG+/IgM+, suggestive of recent infection. The newborn group had the highest frequency (27%) of the IgG+/IgM+ profile. By RFLP analysis, only one genotype was observed, gB2, which corresponded to the standard AD169 strain. CONCLUSIONS: The presence of IgM antibodies in new borns indicates that HCMV continues to be an important cause of congenital infection. The low observed genotypic diversity could be attributed to the small sample size because newborns were excluded from the RFLP analysis. This study will be continued including samples from newborns to extend the knowledge of the general and molecular epidemiology of HCMV in immunodeficient patients.

Sexually transmitted diseases in homosexual and bisexual males from a cohort of human immunodeficiency virus negative volunteers (Project Horizonte), Belo Horizonte, Brazil

Sexually transmitted diseases (STD) are very frequent in the whole world. Males who do not use a condom during their sexual relations are at great risk. We report cases of STD during six months of observation, among homosexual/bisexual males who participate in the Project Horizonte. There were 16 cases of genital warts, 6 cases of human immunodeficiency virus infection, 24 cases of unspecific urethritis, 28 cases of herpes simplex virus infection, 30 cases of syphilis, 58 cases of gonorrhea and 84 cases of pediculosis. We concluded that a condom must be used in all sexual relations and new counseling techniques are needed, to avoid this situation.

Determinants of Human Immunodeficiency Virus (HIV) prevalence in homosexual and bisexual men screened for admission to a cohort study of HIV negatives in Belo Horizonte, Brazil: Project Horizonte

Project Horizonte, an open cohort of homosexual and bisexual human immunodeficiency virus (HIV-1) negative men, is a component of the AIDS Vaccine Program, in Belo Horizonte, Minas Gerais, Brazil. The objective of this study was to compare volunteers testing HIV positive at cohort entry with a sample of those who tested HIV negative in order to identify risk factors for prevalent HIV infection, in a population being screened for enrollment at Project Horizonte. A nested case-control study was conducted. HIV positive volunteers at entry (cases) were matched by age and admission date to three HIV negative controls each. Selected variables used for the current analysis included demographic factors, sexual behavior and other risk factors for HIV infection. During the study period (1994-2001), among the 621 volunteers screened, 61 tested positive for HIV. Cases were matched to 183 HIV negative control subjects. After adjustments, the main risk factors associated with HIV infection were unprotected sex with an occasional partners, OR = 3.7 (CI 95% 1.3-10.6), receptive anal intercourse with an occasional partner, OR = 2.8 (95% CI 0.9-8.9) and belonging to the negro racial group, OR = 3.4 (CI 95% 1.1-11.9). These variables were associated with an increase in the risk of HIV infection among men who have sex with men at the screening for admission to an open HIV negative cohort.

Identification of the Boudicca and Sinbad retrotransposons in the genome of the human blood fluke Schistosoma haematobium

Schistosomes have a comparatively large genome, estimated for Schistosoma mansoni to be about 270 megabase pairs (haploid genome). Recent findings have shown that mobile genetic elements constitute significant proportions of the genomes of S. mansoni and S. japonicum. Much less information is available on the genome of the third major human schistosome, S. haematobium. In order to investigate the possible evolutionary origins of the S. mansoni long terminal repeat retrotransposons Boudicca and Sinbad, several genomes were searched by Southern blot for the presence of these retrotransposons. These included three species of schistosomes, S. mansoni, S. japonicum, and S. haematobium, and three related platyhelminth genomes, the liver flukes Fasciola hepatica and Fascioloides magna and the planarian, Dugesia dorotocephala. In addition, Homo sapiens and three snail host genomes, Biomphalaria glabrata, Oncomelania hupensis, and Bulinus truncatus, were examined for possible indications of a horizontal origin for these retrotransposons. Southern hybridization analysis indicated that both Boudicca and Sinbad were present in the genome of S. haematobium. Furthermore, low stringency Southern hybridization analyses suggested that a Boudicca-like retrotransposon was present in the genome of B. truncatus, the snail host of S. haematobium.

What new cell biology findings could bring to therapeutics: is it time for a phenome-project in Toxoplasma gondii?

"If you know the enemy and know yourself, you need not fear the result of a hundred battles. If you know yourself but not the enemy, for every victory gained you will also suffer a defeat" (SunTzu the Art of War, 544-496 BC). Although written for the managing of conflicts and winning clear victories, this basic guideline can be directly transferred to our battle against apicomplexan parasites and how to focus future basic research in order to transfer the gained knowledge to a therapeutic intervention stratey. Over the last two decades the establishment of several key-technologies, by different groups working on Toxoplasma gondii, made this important human pathogen accessible to modern approaches in molecular cell biology. In fact more and more researchers get attracted to this easy accessible model organism to study specific biological questions, unique to apicomplexans. This fascinating, unique biology might provide us with new therapeutic options in our battle against apicomplexan parasites by finding its Achilles' heel. In this article we argue that in the absence of a powerful high throughput technology for the characterisation of essential gene of interests a coordinated effort should be undertaken to convert our knowledge of the genome into one of the phenome.

Human DNA repair diseases: From genome instability to cancer

Several human genetic syndromes have long been recognized to be defective in DNA repair mechanisms. This was first discovered by Cleaver (1968), who showed that cells from patients with xeroderma pigmentosum (XP) were defective for the ability to remove ultraviolet (UV)-induced lesions from their genome. Since then, new discoveries have promoted DNA repair studies to one of the most exciting areas of molecular biology. The present work intends to give a brief summary of the main known human genetic diseases related to DNA repair and how they may be linked to acquired diseases such as cancer

What can digital transcript profiling reveal about human cancers?

Important biological and clinical features of malignancy are reflected in its transcript pattern. Recent advances in gene expression technology and informatics have provided a powerful new means to obtain and interpret these expression patterns. A comprehensive approach to expression profiling is serial analysis of gene expression (SAGE), which provides digital information on transcript levels. SAGE works by counting transcripts and storing these digital values electronically, providing absolute gene expression levels that make historical comparisons possible. SAGE produces a comprehensive profile of gene expression and can be used to search for candidate tumor markers or antigens in a limited number of samples. The Cancer Genome Anatomy Project has created a SAGE database of human gene expression levels for many different tumors and normal reference tissues and provides online tools for viewing, comparing, and downloading expression profiles. Digital expression profiling using SAGE and informatics have been useful for identifying genes that have a role in tumor invasion and other aspects of tumor progression.

Epidemiological studies in the information and genomics era: experience of the Clinical Genome of Cancer Project in São Paulo, Brazil

Genomics is expanding the horizons of epidemiology, providing a new dimension for classical epidemiological studies and inspiring the development of large-scale multicenter studies with the statistical power necessary for the assessment of gene-gene and gene-environment interactions in cancer etiology and prognosis. This paper describes the methodology of the Clinical Genome of Cancer Project in São Paulo, Brazil (CGCP), which includes patients with nine types of tumors and controls. Three major epidemiological designs were used to reach specific objectives: cross-sectional studies to examine gene expression, case-control studies to evaluate etiological factors, and follow-up studies to analyze genetic profiles in prognosis. The clinical groups included patients' data in the electronic database through the Internet. Two approaches were used for data quality control: continuous data evaluation and data entry consistency. A total of 1749 cases and 1509 controls were entered into the CGCP database from the first trimester of 2002 to the end of 2004. Continuous evaluation showed that, for all tumors taken together, only 0.5% of the general form fields still included potential inconsistencies by the end of 2004. Regarding data entry consistency, the highest percentage of errors (11.8%) was observed for the follow-up form, followed by 6.7% for the clinical form, 4.0% for the general form, and only 1.1% for the pathology form. Good data quality is required for their transformation into useful information for clinical application and for preventive measures. The use of the Internet for communication among researchers and for data entry is perhaps the most innovative feature of the CGCP. The monitoring of patients' data guaranteed their quality.

Stability of XIST repression in relation to genomic imprinting following global genome demethylation in a human cell line

DNA methylation is essential in X chromosome inactivation and genomic imprinting, maintaining repression of XIST in the active X chromosome and monoallelic repression of imprinted genes. Disruption of the DNA methyltransferase genes DNMT1 and DNMT3B in the HCT116 cell line (DKO cells) leads to global DNA hypomethylation and biallelic expression of the imprinted gene IGF2 but does not lead to reactivation of XIST expression, suggesting thatXIST repression is due to a more stable epigenetic mark than imprinting. To test this hypothesis, we induced acute hypomethylation in HCT116 cells by 5-aza-2′-deoxycytidine (5-aza-CdR) treatment (HCT116-5-aza-CdR) and compared that to DKO cells, evaluating DNA methylation by microarray and monitoring the expression of XIST and imprinted genes IGF2, H19, and PEG10. Whereas imprinted genes showed biallelic expression in HCT116-5-aza-CdR and DKO cells, the XIST locus was hypomethylated and weakly expressed only under acute hypomethylation conditions, indicating the importance ofXIST repression in the active X to cell survival. Given that DNMT3A is the only active DNMT in DKO cells, it may be responsible for ensuring the repression of XIST in those cells. Taken together, our data suggest that XIST repression is more tightly controlled than genomic imprinting and, at least in part, is due to DNMT3A.

Mental health research in Brazil: policies, infrastructure, financing and human resources

The objective of this descriptive study was to map mental health research in Brazil, providing an overview of infrastructure, financing and policies mental health research. As part of the Atlas-Research Project, a WHO initiative to map mental health research in selected low and middle-income countries, this study was carried out between 1998 and 2002. Data collection strategies included evaluation of governmental documents and sites and questionnaires sent to key professionals for providing information about the Brazilian mental health research infrastructure. In the year 2002, the total budget for Health Research was US$101 million, of which US$3.4 million (3.4) was available for Mental Health Research. The main funding sources for mental health research were found to be the São Paulo State Funding Agency (Fapesp, 53.2%) and the Ministry of Education (CAPES, 30.2%). The rate of doctors is 1.7 per 1,000 inhabitants, and the rate of psychiatrists is 2.7 per 100,000 inhabitants estimated 2000 census. In 2002, there were 53 postgraduate courses directed to mental health training in Brazil (43 in psychology, six in psychiatry, three in psychobiology and one in psychiatric nursing), with 1,775 students being trained in Brazil and 67 overseas. There were nine programs including psychiatry, neuropsychiatry, psychobiology and mental health, seven of them implemented in Southern states. During the five-year period, 186 students got a doctoral degree (37 per year) and 637 articles were published in Institute for Scientic Information (ISI)-indexed journals. The investment channeled towards postgraduate and human resource education programs, by means of grants and other forms of research support, has secured the country a modest but continuous insertion in the international knowledge production in the mental health area.