Effect of metabolic syndrome and of its individual components on renal function of patients with type 2 diabetes mellitus

The objective of this study was to evaluate the effect of metabolic syndrome (MetS) and its individual components on the renal function of patients with type 2 diabetes mellitus (DM). A cross-sectional study was performed in 842 type 2 DM patients. A clinical and laboratory evaluation, including estimated glomerular filtration rate (eGFR) calculated by the modification of diet in renal disease formula, was performed. MetS was defined according to National Cholesterol Education Program - Adult Treatment Panel III criteria. Mean patient age was 57.9 ± 10.1 years and 313 (37.2%) patients were males. MetS was detected in 662 (78.6%) patients. A progressive reduction in eGFR was observed as the number of individual MetS components increased (one: 98.2 ± 30.8; two: 92.9 ± 28.1; three: 84.0 ± 25.1; four: 83.8 ± 28.5, and five: 79.0 ± 23.0; P < 0.001). MetS increased the risk for low eGFR (<60 mL·min-1·1.73 (m²)-1) 2.82-fold (95%CI = 1.55-5.12, P < 0.001). Hypertension (OR = 2.2, 95%CI = 1.39-3.49, P = 0.001) and hypertriglyceridemia (OR = 1.62, 95%CI = 1.19-2.20, P = 0.002) were the individual components with the strongest associations with low eGFR. In conclusion, there is an association between MetS and the reduction of eGFR in patients with type 2 DM, with hypertension and hypertriglyceridemia being the most important contributors in this sample. Interventional studies should be conducted to determine if treatment of MetS can prevent renal failure in type 2 DM patients.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Diabetes mellitus affects the biomechanical function of the callus and the expression of TGF-beta1 and BMP2 in an early stage of fracture healing

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

Thermophysical and rheological properties of dulce de leche with and without coconut flakes as a function of temperature

Dulce de leche (DL), a dairy dessert highly appreciated in Brazil, is a concentrated product containing about 70% m/m of total solids. Thermophysical and rheological properties of two industrial Brazilian Dulce de leche formulations (classic Dulce de leche and Dulce de leche added with coconut flakes 1.5% m/m) were determined at temperatures comprised between 28.4 and 76.4 °C. In general, no significant differences (p < 0.05) were observed in the presence of coconut flakes in the two formulations. Heat capacity varied from 2633.2 to 3101.8 J/kg.°C; thermal conductivity from 0.383 to 0.452 W/m.°C; specific mass from 1350.7 to 1310.7 kg/m³; and, thermal diffusivity from (1.082 × 10-7 to 1.130 × 10-7) m²/s. The Bingham model was used to properly describe the non-Newtonian behavior of both formulations, with yielding stress values varying from 27.3 to 17.6 Pa and plastic viscosity from 19.9 to 5.9 Pa.s.

Prevalence of anti-p: Falciparum sporozoite antibodies in adults in the amapa region of Brazil

17 of 20 adult sera from the Amapa region of Brazil were active in the inhibition of P. falciparum sporozoite invasion (ISI) assay which has been correlated with protective antibodies. In contrast 11 sera were positive in IFA tests and 6 were positive in CSP tests. These results suggest that the ISI assay will be useful for evaluating naturally acquired protective anti-sporozoite antibodies in endemic areas, particularly during vaccine efficacy studies using sporozoite-based vaccines.

Characterization of rotavirus P genotypes circulating among paediatric inpatients in Northern Brazil

Between November 1992 and August 1993, twenty-eight rotavirus-positive stool samples obtained from paediatric inpatients in Belém, Brazil, aged less than four years, were tested by RT-PCR to determine the P genotype specificities. With the exception of 7 non-diarrhoeic children, all patients were either diarrhoeic at admission or developed diarrhoea while in hospital. Rotavirus strains with the gene 4 alleles corresponding to P1B[4] and P1A[8] types (both of which bearing G2 specificity) predominated, accounting for 78.6% of the strains. While only one P2A[6] type strain - with (mixed) G1 and 4 type specificities - was detected, the gene 4 allele could not be identified in 4 (14.3%) of the strains. Most (81%) of the specimens were obtained from children during their first 18 months of life. Rotavirus strains bearing single P1B[4] type-specificity were identified in both diarrhoeic (either nosocomial, 28.6% or community-acquired diarrhoea, 28.6%) and non-diarrhoeic (42.8%) children. P1A[8] gene 4 allele, on the other hand, was detected only among diarrhoeic children, at rates of 57.1% and 42.9% for nosocomial- and- community acquired diarrhoea, respectively. Mixed P1A[8],1B[4] type infection was identified in only one case of community-acquired diarrhoea.

Litterfall production in intact and selectively logged forests in southern of Amazonia as a function of basal area of vegetation and plant density

Nutrient recycling in the forest is linked to the production and decomposition of litter, which are essential processes for forest maintenance, especially in regions of nutritionally poor soils. Human interventions in forest such as selecttive logging may have strong impacts on these processes. The objectives of this study were to estimate litterfall production and evaluate the influence of environmental factors (basal area of vegetation, plant density, canopy cover, and soil physicochemical properties) and anthropogenic factors (post-management age and exploited basal area) on this production, in areas of intact and exploited forest in southern Amazonia, located in the northern parts of Mato Grosso state. This study was conducted at five locations and the average annual production of litterfall was 10.6 Mg ha-1 year-1, higher than the values for the Amazon rainforest. There were differences in litterfall productions between study locations. Effects of historical logging intensity on litterfall production were not significant. Effects of basal area of vegetation and tree density on litterfall production were observed, highlighting the importance of local vegetation characteristics in litterfall production. This study demonstrated areas of transition between the Amazonia-Cerrado tend to have a higher litterfall production than Cerrado and Amazonia regions, and this information is important for a better understanding of the dynamics of nutrient and carbon cycling in these transition regions.

Effects of protein-calorie restriction on mechanical function of hypertrophied cardiac muscle

OBJECTIVE: To assess the effect of food restriction (FR) on hypertrophied cardiac muscle in spontaneously hypertensive rats (SHR). METHODS: Isolated papillary muscle preparations of the left ventricle (LV) of 60-day-old SHR and of normotensive Wistar-Kyoto (WKY) rats were studied. The rats were fed either an unrestricted diet or FR diet (50% of the intake of the control diet) for 30 days. The mechanical function of the muscles was evaluated through monitoring isometric and isotonic contractions. RESULTS: FR caused: 1) reduction in the body weight and LV weight of SHR and WKY rats; 2) increase in the time to peak shortening and the time to peak developed tension (DT) in the hypertrophied myocardium of the SHR; 3) diverging changes in the mechanical function of the normal cardiac muscles of WKY rats with reduction in maximum velocity of isotonic shortening and of the time for DT to decrease 50% of its maximum value, and increase of the resting tension and of the rate of tension decline. CONCLUSION: Short-term FR causes prolongation of the contraction time of hypertrophied muscles and paradoxal changes in mechanical performance of normal cardiac fibers, with worsening of the shortening indices and of the resting tension, and improvement of the isometric relaxation.

Expression and function of beta1 integrins on human eosinophils

Eosinophils preferentially accumulate at sites of chronic allergic diseases such as bronchial asthma. The mechanisms by which selective eosinophil migration occurs are not fully understood. However, interactions of cell-surface adhesion molecules on the eosinophil with molecular counterligands on endothelial and epithelial cells, and on extracellular matrix proteins, are likely to be critical during the recruitment process. One possible mechanism for selective eosinophil recruitment involves the alpha4beta 1 (VLA-4) integrin which is not expressed on neutrophils. Correlations have been found between infiltration of eosinophils and endothelial expression of VCAM-1, the ligand for VLA-4, in the lungs of asthmatic individuals as well as in late phase reactions in the lungs, nose and skin. Epithelial and endothelial cells respond to the Th2-type cytokines IL-4 and IL-13 with selective de novo expression of VCAM-1, consistent with the possible role of VCAM-1/VLA-4 interactions in eosinophil influx during allergic inflammation. Both beta 1 and beta 2 integrins on eosinophils exist in a state of partial activation. For example, eosinophils can be maximally activated for adhesion to VCAM-1 or fibronectin after exposure to beta 1 integrin-activating antibodies or divalent cations, conditions that do not necessarily affect the total cell surface expression of beta 1 integrins. In contrast, cytokines like IL-5 prevent beta 1 integrin activation while promoting beta 2 integrin function. Furthermore, ligation of integrins can regulate the effector functions of the cell. For example, eosinophil adhesion via beta 1 and/or beta 2 integrins has been shown to alter a variety of functional responses including degranulation and apoptosis. Thus, integrins appear to be important in mediating eosinophil migration and activation in allergic inflammation. Strategies that interfere with these processes may prove to be useful for treatment of allergic diseases.

Heterologous expression and biochemical characterization of an α1,2-mannosidase encoded by the Candida albicans MNS1 gene

Protein glycosylation pathways, commonly found in fungal pathogens, offer an attractive new area of study for the discovery of antifungal targets. In particular, these post-translational modifications are required for virulence and proper cell wall assembly in Candida albicans, an opportunistic human pathogen. The C. albicans MNS1 gene is predicted to encode a member of the glycosyl hydrolase family 47, with 1,2-mannosidase activity. In order to characterise its activity, we first cloned the C. albicans MNS1 gene into Escherichia coli, then expressed and purified the enzyme. The recombinant Mns1 was capable of converting a Man9GlcNAc2 N-glycan core into Man8GlcNAc2 isomer B, but failed to process a Man5GlcNAc2-Asn N-oligosaccharide. These properties are similar to those displayed by Mns1 purified from C. albicansmembranes and strongly suggest that the enzyme is an ±1,2-mannosidase that is localised to the endoplasmic reticulum and involved in the processing of N-linked mannans. Polyclonal antibodies specifically raised against recombinant Mns1 also immunoreacted with the soluble ±1,2-mannosidases E-I and E-II, indicating that Mns1 could share structural similarities with both soluble enzymes. Due to the high degree of similarity between the members of family 47, it is conceivable that these antibodies may recognise ±1,2-mannosidases in other biological systems as well.

Molecular characterization of G and P-types bovine rotavirus strains from Goiás, Brazil: high frequency of mixed P-type infections

In this study, 331 samples from calves less than one month old from a dairy herd in the district of Piracanjuba, state of Goiás, Brazil were tested for rotavirus. Thirty-three samples (9.9%) tested positive for rotavirus. Out of those, 31 were submitted to G and P characterization by reverse transcription followed by semi-nested polymerase chain reaction. Two samples were characterized as G6P[1], three as G10P[11] and five as G6P[11]. The majority of the samples (51.6%) displayed multiple P genotypes (P-genotype mixtures), including typical human genotypes P[4] and P[6M], suggesting the occurrence of co-infections and genetic reassortment. Also, the detection of human genotypes in bovine samples may be considered evidence of the zoonotic potential of rotaviruses. To our knowledge, this is the first report of such a high frequency of P genotype mixtures in bovine rotavirus samples. It also increases data on G and P rotavirus genotypes circulating in dairy herds in Brazil and can help in the development of more efficient immunization approaches, thereby controlling infection and reducing economical losses.

MODELING OF SOIL LOAD-BEARING CAPACITY AS A FUNCTION OF SOIL MECHANICAL RESISTANCE TO PENETRATION

Estimation of soil load-bearing capacity from mathematical models that relate preconsolidation pressure (σp) to mechanical resistance to penetration (PR) and gravimetric soil water content (U) is important for defining strategies to prevent compaction of agricultural soils. Our objective was therefore to model the σp and compression index (CI) according to the PR (with an impact penetrometer in the field and a static penetrometer inserted at a constant rate in the laboratory) and U in a Rhodic Eutrudox. The experiment consisted of six treatments: no-tillage system (NT); NT with chiseling; and NT with additional compaction by combine traffic (passing 4, 8, 10, and 20 times). Soil bulk density, total porosity, PR (in field and laboratory measurements), U, σp, and CI values were determined in the 5.5-10.5 cm and 13.5-18.5 cm layers. Preconsolidation pressure (σp) and CI were modeled according to PR in different U. The σp increased and the CI decreased linearly with increases in the PR values. The correlations between σp and PR and PR and CI are influenced by U. From these correlations, the soil load-bearing capacity and compaction susceptibility can be estimated by PR readings evaluated in different U.

Simulating maize phenology as a function of air temperature with a linear and a nonlinear model

The objective of this study was to adapt a nonlinear model (Wang and Engel - WE) for simulating the phenology of maize (Zea mays L.), and to evaluate this model and a linear one (thermal time), in order to predict developmental stages of a field-grown maize variety. A field experiment, during 2005/2006 and 2006/2007 was conducted in Santa Maria, RS, Brazil, in two growing seasons, with seven sowing dates each. Dates of emergence, silking, and physiological maturity of the maize variety BRS Missões were recorded in six replications in each sowing date. Data collected in 2005/2006 growing season were used to estimate the coefficients of the two models, and data collected in the 2006/2007 growing season were used as independent data set for model evaluations. The nonlinear WE model accurately predicted the date of silking and physiological maturity, and had a lower root mean square error (RMSE) than the linear (thermal time) model. The overall RMSE for silking and physiological maturity was 2.7 and 4.8 days with WE model, and 5.6 and 8.3 days with thermal time model, respectively.

Dry matter production of Tanzania grass as a function of agrometeorological variables

The objective of this work was to develop and validate linear regression models to estimate the production of dry matter by Tanzania grass (Megathyrsus maximus, cultivar Tanzania) as a function of agrometeorological variables. For this purpose, data on the growth of this forage grass from 2000 to 2005, under dry‑field conditions in São Carlos, SP, Brazil, were correlated to the following climatic parameters: minimum and mean temperatures, degree‑days, and potential and actual evapotranspiration. Simple linear regressions were performed between agrometeorological variables (independent) and the dry matter accumulation rate (dependent). The estimates were validated with independent data obtained in São Carlos and Piracicaba, SP, Brazil. The best statistical results in the development and validation of the models were obtained with the agrometeorological parameters that consider thermal and water availability effects together, such as actual evapotranspiration, accumulation of degree‑days corrected by water availability, and the climatic growth index, based on average temperature, solar radiation, and water availability. These variables can be used in simulations and models to predict the production of Tanzania grass.

Gas exchanges in peach palms as a function of the spad chlorophyll meter readings

The close relationship between the chlorophyll-meters readings and the total chlorophyll and nitrogen contents in leaves, has allowed their evaluation both in annual and perennial species. Besides, some physiological events such as the CO2 assimilation have also been estimated by chlorophyll meters. This work was carried out aiming to evaluate the gas exchanges of peach palms as a function of the chlorophyll SPAD-Meter readings. Three year-old peach palms from Yurimaguas, Peru were studied in Ubatuba, SP, Brazil, spaced 2 x 1 m in area under a natural gradient of organic matter which allowed four plots to be considered, according to the peach palms leaves colors, from light yellow to dark green. The SPAD readings and the stomatal frequency of leaflets were evaluated. The photosynthetic photon flux density (PPFD, μmol m-2 s-1), the leaf temperature (Tleaf, ºC), the CO2 assimilation (A, μmol m-2 s-1), the stomatal conductance (g s, mol m-2 s-1), the transpiration (E, mmol m-2 s-1) and the intercellular CO2 concentration (Ci, μmol mol-1) were evaluated with a portable infrared gas analyzer (LCA-4, ADC BioScientific Ltd., Great Amwell, U.K.). A linear increase in the CO2 assimilation as a function of the SPAD readings (y = -0.34 + 0.19x, R² = 0.99), indicates that they can be a rapid and cheap complementary method to evaluate in peach palms some important physiological events, such as CO2 assimilation.