87 resultados para Frequency response function
Resumo:
Endothelial function (EF) plays an important role in the onset and clinical course of atherosclerosis, although its relationship with the presence and extent of coronary artery disease (CAD) has not been well defined. We evaluated EF and the ST segment response to an exercise test in patients with a broad spectrum of CAD defined by coronary angiography. Sixty-two patients submitted to diagnostic catheterization for the evaluation of chest pain or ischemia in a provocative test were divided into three groups according to the presence and severity of atherosclerotic lesions (AL): group 1: normal coronaries (N = 19); group 2: CAD with AL <70% (N = 17); group 3: CAD with AL ≥70% (N = 26). EF was evaluated by the percentage of flow-mediated dilatation (%FMD) in the brachial artery during reactive hyperemia induced by occlusion of the forearm with a pneumatic cuff for 5 min. Fifty-four patients were subjected to an exercise test. Gender and age were not significantly correlated with %FMD. EF was markedly reduced in both groups with CAD (76.5 and 73.1% vs 31.6% in group 1) and a higher frequency of ischemic alterations in the ST segment (70.8%) was observed in the group with obstructive CAD with AL ≥70% during the exercise test. Endothelial dysfunction was observed in patients with CAD, irrespective of the severity of injury. A significantly higher frequency of ischemic alterations in the ST segment was observed in the group with obstructive CAD. EF and exercise ECG differed among the three groups and may provide complementary information for the assessment of CAD.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
OBJECTIVE: To examine the effects of the length and timing of nighttime naps on performance and physiological functions, an experimental study was carried out under simulated night shift schedules. METHODS: Six students were recruited for this study that was composed of 5 experiments. Each experiment involved 3 consecutive days with one night shift (22:00-8:00) followed by daytime sleep and night sleep. The experiments had 5 conditions in which the length and timing of naps were manipulated: 0:00-1:00 (E60), 0:00-2:00 (E120), 4:00-5:00 (L60), 4:00-6:00 (L120), and no nap (No-nap). During the night shifts, participants underwent performance tests. A questionnaire on subjective fatigue and a critical flicker fusion frequency test were administered after the performance tests. Heart rate variability and rectal temperature were recorded continuously during the experiments. Polysomnography was also recorded during the nap. RESULTS: Sleep latency was shorter and sleep efficiency was higher in the nap in L60 and L120 than that in E60 and E120. Slow wave sleep in the naps in E120 and L120 was longer than that in E60 and L60. The mean reaction time in L60 became longer after the nap, and faster in E60 and E120. Earlier naps serve to counteract the decrement in performance and physiological functions during night shifts. Performance was somewhat improved by taking a 2-hour nap later in the shift, but deteriorated after a one-hour nap. CONCLUSIONS: Naps in the latter half of the night shift were superior to earlier naps in terms of sleep quality. However performance declined after a 1-hour nap taken later in the night shift due to sleep inertia. This study suggests that appropriate timing of a short nap must be carefully considered, such as a 60-min nap during the night shift.
Resumo:
ABSTRACT OBJECTIVE To describe the response rate and characteristics of people who either took part or not in from the Study of Cardiovascular Risks in Adolescents (ERICA) , according to information subsets. METHODS ERICA is a school-based, nation-wide investigation with a representative sample of 12 to 17-year-old adolescents attending public or private schools in municipalities with over 100,000 inhabitants in Brazil. Response rate of eligible subjects were calculated according to macro-regions, sex, age, and type of school (public or private). We also calculated the percentages of replacement schools in comparison with the ones originally selected as per the sample design, according to the types of schools in the macro-regions. The subjects and non-subjects were compared according to sex, age, and average body mass indices (kg/m2). RESULTS We had 102,327 eligible adolescents enrolled in the groups drawn. The highest percentage of complete information was obtained for the subset of the questionnaire (72.9%). Complete information regarding anthropometric measurements and the ones from the questionnaire were obtained for 72.0% of the adolescents, and the combination of these data with the 24-hour dietary recall were obtained for 70.3% of the adolescents. Complete information from the questionnaire plus biochemical blood evaluation data were obtained for 52.5% of the morning session adolescents (selected for blood tests). The response percentage in private schools was higher than the one in public schools for most of the combination of information. The ratio of older and male adolescents non-participants was higher than the ratio among participants. CONCLUSIONS The response rate for non-invasive procedures was high. The response rate for blood collection – an invasive procedure that requires a 12-hour fasting period and the informed consent form from legal guardians – was lower. The response rate observed in public schools was lower than in the private ones, and that may reflect lower school frequency of registered students.
Resumo:
Cell mediated immune response was studied in patients with recent and chronic Schistosoma mansoni infection. Precultured peripheral mononuclear cells showed significantly higher responses to S. mansoni adult worm antigen (SAWA) when compared to fresh cell preparations. The addition of each patient serum to the precultured cells reactions to SAWA or recall antigens demonstrated a strong inhibitory serum action, which was also noted on allogeneic cells derived from healthy subjects. The CD4 subset was the main responding cell to SAWA being this reactivity highly suppressed by the presence of the monocyte macrophage accessory cells. We stressed the simultaneous inhibitory action of humoral and cellular factors on the specific cell response to S. mansoni.
Resumo:
Leptospirosis severity may be increasing, with pulmonary involvement becoming more frequent. Does this increase result from an intense immune response to leptospire? Notice that renal failure, thrombocytopenia and pulmonary complications are found during the immune phase. Thirty-five hospitalized patients with Weil's disease had 5 blood samples drawn, from the 15th day to the 12th month of symptoms, for ELISA-IgM, -IgG and -IgA specific antibody detection. According their 1st IgG titer, the patients were divided into: group 1 (n = 13) titer > 1:400 (positive) and group 2 (n = 22) titer <=1:400 (negative). Early IgG antibodies in group 1 showed high avidity which may indicate reinfection. Group 1 was older, had worse pulmonary and renal function, and fever for a longer period than group 2. Throughout the study, IgG and IgA titers remained higher in group 1. In conclusion, the severity of Weil's disease may be associated with the intensity of the humoral immune response to leptospire.
Resumo:
In the present study the frequencies of immunity against hepatitis B (HB) and of potentially contaminating accidents among medical students of a Brazilian public university were evaluated. Of all the 400 students who should have been immunized, 303 (75.7%), 66.3% of whom were women, answered an anonymous, self-administered questionnaire. Serum anti-HBs were determined in 205 of them and titers > 10 UI/L were considered to be protective. A total of 86.8% of students had received three doses of HB vaccine. The frequency of immunity among women (96.4%) was higher (p = 0.04) than that among men (87.7%). Among those who did not have immunity, 12/13 (92.3%) had been vaccinated before entering medical school. Only 11% of the students with complete vaccination had previously verified serological response to the vaccine. A total of 23.6% reported having been somehow exposed to blood or secretions. Among final-year students, this frequency was 45.0%, being similar among men (47.8%) and women (43.2%). Of all these accidents, 57.7% were due to body fluids coming in contact with mucosa and 42.3% due to cut and puncture accidents. The results from this study show that: 1) the frequency of immunity against HB is high among the evaluated medical students, although verification of response to vaccination is not a concern for them; 2) anti-HBs titers should be verified after complete vaccination and on a regular basis, especially by men; and 3) the frequency of potentially contaminating accidents is high.
Resumo:
Antibody response to Salmonella typhi O and H antigens was evaluated in 24 individuals with either hepatointestinal or hepatosplenic schistosomiasis mansoni before and after typhoid vaccination, and compared with that of non-infected controls. Before vaccination, Schistosoma-infected patients showed a higher frequency of positive antibody to O antigen and the same frequency to H antigen when compared with that of healthy individuals. However, those with hepatosplenic schistosomiasis showed higher titres of antibody to H antigen than those with hepatointestinal disease or healthy individuals. Infected subjects, particularly those with hepatointestinal disease, showed a decreased response after typhoid vaccine. Tins diminished ability to mount an immune response towards typhoid antigens dining schistosomiasis may interfere ivith the clearance of the bacteria from blood stream and, therefore, play a role in the prolonged survival of salmonella as obsewed in some patients with chronic salmonellosis associated with schistosomiasis.
Resumo:
In this study, the events following application of the insecticideDemand 2.5 concentrated solution (CS) in the field, to control Tityus stigmurus, were investigated. Data on attitudes and practices relating to scorpionism were collected using a questionnaire. During the months of May to July 2005, 69 premises were monitored on different days following insecticide treatment, focusing on scorpion frequency and mortality. According to the results, 42% of the premises showed scorpion incidence, with an average of three specimens per house. The highest incidence was recorded during the first week following the treatment. Only 7% of the specimens were found dead. Most (72%) of the population showed knowledge about prevention and control measures. Despite this, 100% of the premises presented breeding sites, mainly in debris (79.7%). These results indicate that the scorpion control method used by health agents during this investigation was not efficient, and the results suggest that the method may have had a dispersive effect on these animals.
Resumo:
Abstract: INTRODUCTION: Due to the importance that Howler monkeys have on the yellow fever (YF) epidemiological sylvatic cycle in Brazil, more accurate morphological diagnostic criteria needs to be established, especially considering the differences that may exist between the genera of Brazilian non-human primates (NHPs) involved in yellow fever virus (YFV) epizootics. METHODS: Records of YF epizootics in NHPs in Brazil between 2007 and 2009 were obtained from the Brazilian Ministry of Health database to select YF positive (n=98) Howler monkeys (Alouatta sp.) for this study. The changes described in the histopathological reports were categorized by organ and their frequencies calculated. RESULTS: The most frequent lesions observed in the animals with YF were hepatocyte apoptosis (Councilman body formation), midzonal hepatocyte necrosis, steatosis, liver hemorrhage, inflammatory mononuclear cell infiltration of the liver, renal acute tubular necrosis and interstitial nephritis. Midzonal hepatocyte necrosis, steatosis and hemorrhage presented positive correlations with apoptosis of hepatocytes, suggesting strong YFV pathogenic effect association; they were also the main histopathological changes in the Alouatta sp. A pronounced negative correlation between apoptosis of hepatocytes and hepatic mononuclear cell infiltration pointed to significant histopathological differences between YFV infection in Howler monkeys and humans. CONCLUSIONS: The results warn that NHPs may exhibit different response patterns following YFV infection and require a more careful diagnosis. Presumptive diagnosis based on primate histopathological lesions may contribute to public health service control.
Resumo:
OBJECTIVE: To assess the acute effects of high glucose concentrations on vascular reactivity in the isolated non diabetic rabbit kidney. METHODS: Rabbits were anaesthetized for isolation of the kidneys. Renal arteries and veins were cannulated for perfusion with Krebs-Henselleit solution and measurement of perfusion pressure. After 3 hours of perfusion with glucose 5,5 mM (control ) and 15 mM, the circulation was submitted to sub maximal precontraction (80% of maximal response) trough continuous infusion of noradrenaline 10 mM. Vascular reactivity was then assessed trough dose-responses curves with endothelium-dependent (acetylcholine) and independent (sodium nitroprusside) vasodilators. The influence of hyperosmolarity was analyzed with perfusion with mannitol 15mM. RESULTS: A significant reduction in the endothelium-dependent vasodilation in glucose 15mM group was observed compared to that in control, but there was no difference in endothelium-independent vasodilation. After perfusion with mannitol 15 mM, a less expressive reduction in endothelium-dependent vasodilation was observed, only reaching significance in regard to the greatest dose of acetylcholine. CONCLUSION: High levels of glucose similar to those found in diabetic patients in the postprandial period can cause significant acute changes in renal vascular reactivity rabbits. In diabetic patients these effects may also occur and contribute to diabetes vascular disease.
Resistance Exercise Restores Endothelial Function and Reduces Blood Pressure in Type 1 Diabetic Rats
Resumo:
Background: Resistance exercise effects on cardiovascular parameters are not consistent. Objectives: The effects of resistance exercise on changes in blood glucose, blood pressure and vascular reactivity were evaluated in diabetic rats. Methods: Wistar rats were divided into three groups: control group (n = 8); sedentary diabetic (n = 8); and trained diabetic (n = 8). Resistance exercise was carried out in a squat device for rats and consisted of three sets of ten repetitions with an intensity of 50%, three times per week, for eight weeks. Changes in vascular reactivity were evaluated in superior mesenteric artery rings. Results: A significant reduction in the maximum response of acetylcholine-induced relaxation was observed in the sedentary diabetic group (78.1 ± 2%) and an increase in the trained diabetic group (95 ± 3%) without changing potency. In the presence of NG-nitro-L-arginine methyl ester, the acetylcholine-induced relaxation was significantly reduced in the control and trained diabetic groups, but not in the sedentary diabetic group. Furthermore, a significant increase (p < 0.05) in mean arterial blood pressure was observed in the sedentary diabetic group (104.9 ± 5 to 126.7 ± 5 mmHg) as compared to that in the control group. However, the trained diabetic group showed a significant decrease (p < 0.05) in the mean arterial blood pressure levels (126.7 ± 5 to 105.1 ± 4 mmHg) as compared to the sedentary diabetic group. Conclusions: Resistance exercise could restore endothelial function and prevent an increase in arterial blood pressure in type 1 diabetic rats.
Resumo:
Background: Although resistance exercise training is part of cardiovascular rehabilitation programs, little is known about its role on the cardiac and autonomic function after myocardial infarction. Objective: To evaluate the effects of resistance exercise training, started early after myocardial infarction, on cardiac function, hemodynamic profile, and autonomic modulation in rats. Methods: Male Wistar rats were divided into four groups: sedentary control, trained control, sedentary infarcted and trained infarcted rats. Each group with n = 9 rats. The animals underwent maximum load test and echocardiography at the beginning and at the end of the resistance exercise training (in an adapted ladder, 40% to 60% of the maximum load test, 3 months, 5 days/week). At the end, hemodynamic, baroreflex sensitivity and autonomic modulation assessments were made. Results: The maximum load test increased in groups trained control (+32%) and trained infarcted (+46%) in relation to groups sedentary control and sedentary infarcted. Although no change occurred regarding the myocardial infarction size and systolic function, the E/A ratio (-23%), myocardial performance index (-39%) and systolic blood pressure (+6%) improved with resistance exercise training in group trained infarcted. Concomitantly, the training provided additional benefits in the high frequency bands of the pulse interval (+45%), as well as in the low frequency band of systolic blood pressure (-46%) in rats from group trained infarcted in relation to group sedentary infarcted. Conclusion: Resistance exercise training alone may be an important and safe tool in the management of patients after myocardial infarction, considering that it does not lead to significant changes in the ventricular function, reduces the global cardiac stress, and significantly improves the vascular and cardiac autonomic modulation in infarcted rats.
Resumo:
Background: Stress is associated with cardiovascular diseases. Objective: This study aimed at assessing whether chronic stress induces vascular alterations, and whether these modulations are nitric oxide (NO) and Ca2+ dependent. Methods: Wistar rats, 30 days of age, were separated into 2 groups: control (C) and Stress (St). Chronic stress consisted of immobilization for 1 hour/day, 5 days/week, 15 weeks. Systolic blood pressure was assessed. Vascular studies on aortic rings were performed. Concentration-effect curves were built for noradrenaline, in the presence of L-NAME or prazosin, acetylcholine, sodium nitroprusside and KCl. In addition, Ca2+ flux was also evaluated. Results: Chronic stress induced hypertension, decreased the vascular response to KCl and to noradrenaline, and increased the vascular response to acetylcholine. L-NAME blunted the difference observed in noradrenaline curves. Furthermore, contractile response to Ca2+ was decreased in the aorta of stressed rats. Conclusion: Our data suggest that the vascular response to chronic stress is an adaptation to its deleterious effects, such as hypertension. In addition, this adaptation is NO- and Ca2+-dependent. These data help to clarify the contribution of stress to cardiovascular abnormalities. However, further studies are necessary to better elucidate the mechanisms involved in the cardiovascular dysfunction associated with stressors. (Arq Bras Cardiol. 2014; [online].ahead print, PP.0-0)
Resumo:
Abstract Background: Studies suggest that statins have pleiotropic effects, such as reduction in blood pressure, and improvement in endothelial function and vascular stiffness. Objective: To analyze if prior statin use influences the effect of renin-angiotensin-aldosterone system inhibitors on blood pressure, endothelial function, and vascular stiffness. Methods: Patients with diabetes and hypertension with office systolic blood pressure ≥ 130 mmHg and/or diastolic blood pressure ≥ 80 mmHg had their antihypertensive medications replaced by amlodipine during 6 weeks. They were then randomized to either benazepril or losartan for 12 additional weeks while continuing on amlodipine. Blood pressure (assessed with ambulatory blood pressure monitoring), endothelial function (brachial artery flow-mediated dilation), and vascular stiffness (pulse wave velocity) were evaluated before and after the combined treatment. In this study, a post hoc analysis was performed to compare patients who were or were not on statins (SU and NSU groups, respectively). Results: The SU group presented a greater reduction in the 24-hour systolic blood pressure (from 134 to 122 mmHg, p = 0.007), and in the brachial artery flow-mediated dilation (from 6.5 to 10.9%, p = 0.003) when compared with the NSU group (from 137 to 128 mmHg, p = 0.362, and from 7.5 to 8.3%, p = 0.820). There was no statistically significant difference in pulse wave velocity (SU group: from 9.95 to 9.90 m/s, p = 0.650; NSU group: from 10.65 to 11.05 m/s, p = 0.586). Conclusion: Combined use of statins, amlodipine, and renin-angiotensin-aldosterone system inhibitors improves the antihypertensive response and endothelial function in patients with hypertension and diabetes.