18 resultados para Directly modulated feedback
Resumo:
Ca2+ pumps are important players in smooth muscle contraction. Nevertheless, little information is available about these pumps in the vas deferens. We have determined which subtype of sarco(endo)plasmic reticulum Ca2+-ATPase isoform (SERCA) is expressed in rat vas deferens (RVD) and its modulation by calmodulin (CaM)-dependent mechanisms. The thapsigargin-sensitive Ca2+-ATPase from a membrane fraction containing the highest SERCA levels in the RVD homogenate has the same molecular mass (∼115 kDa) as that of SERCA2 from the rat cerebellum. It has a very high affinity for Ca2+ (Ca0.5 = 780 nM) and a low sensitivity to vanadate (IC50 = 41 µM). These facts indicate that SERCA2 is present in the RVD. Immunoblotting for CaM and Ca2+/calmodulin-dependent protein kinase II (CaMKII) showed the expression of these two regulatory proteins. Ca2+ and CaM increased serine-phosphorylated residues of the 115-kDa protein, indicating the involvement of CaMKII in the regulatory phosphorylation of SERCA2. Phosphorylation is accompanied by an 8-fold increase of thapsigargin-sensitive Ca2+ accumulation in the lumen of vesicles derived from these membranes. These data establish that SERCA2 in the RVD is modulated by Ca2+ and CaM, possibly via CaMKII, in a process that results in stimulation of Ca2+ pumping activity.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Rice flour was processed by extrusion cooking in the presence of variable contents of water and sucrose. The process was carried out in a twin-screw extruder under the conditions given by a centre rotational experimental design of second order. The effects of the independent variables, water content (27.9 to 42.1%), and sucrose content (0.1 to 19.9%) on the physicochemical properties of the extrudates were investigated. The water absorption index (WAI), water solubility index (WSI), volumetric expansion index (VEI), and bulk density (BD) were determined as dependent variables. BD was determined for samples before and after frying. An increase in water contents resulted in higher WAI and VEI, and lower WSI and BD for extrudates before and after frying. Higher sucrose levels led to increased values of WAI and VEI and to reduced values of WSI and BD. Both independent variables had significant influence on the physicochemical properties of rice flour extrudates. However, the sucrose content was the most significant. The interaction between these two independent variables and their quadratic effect were also important for the responses studied.